Incidental Mutation 'R8009:Kcna5'
ID 616797
Institutional Source Beutler Lab
Gene Symbol Kcna5
Ensembl Gene ENSMUSG00000045534
Gene Name potassium voltage-gated channel, shaker-related subfamily, member 5
Synonyms Kv1.5
MMRRC Submission 046049-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.104) question?
Stock # R8009 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 126509514-126512375 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 126510517 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 537 (L537P)
Ref Sequence ENSEMBL: ENSMUSP00000055673 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060972]
AlphaFold Q61762
Predicted Effect probably benign
Transcript: ENSMUST00000060972
AA Change: L537P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000055673
Gene: ENSMUSG00000045534
AA Change: L537P

DomainStartEndE-ValueType
low complexity region 65 80 N/A INTRINSIC
low complexity region 83 94 N/A INTRINSIC
BTB 111 211 5e-7 SMART
Pfam:Ion_trans 240 516 6.6e-54 PFAM
Pfam:Ion_trans_2 424 509 1.4e-15 PFAM
Meta Mutation Damage Score 0.0783 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (54/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Potassium channels represent the most complex class of voltage-gated ino channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. Four sequence-related potassium channel genes - shaker, shaw, shab, and shal - have been identified in Drosophila, and each has been shown to have human homolog(s). This gene encodes a member of the potassium channel, voltage-gated, shaker-related subfamily. This member contains six membrane-spanning domains with a shaker-type repeat in the fourth segment. It belongs to the delayed rectifier class, the function of which could restore the resting membrane potential of beta cells after depolarization and thereby contribute to the regulation of insulin secretion. This gene is intronless, and the gene is clustered with genes KCNA1 and KCNA6 on chromosome 12. Defects in this gene are a cause of familial atrial fibrillation type 7 (ATFB7). [provided by RefSeq, May 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal microglial proliferation and nitric oxide release after LPS treatment or facial nerve lesion. Mice homozygous for a knock-in allele exhibit impaired hypoxic pulmonary vasoconstriction, and resistance to drug-induced cardiac QT prolongation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1b T A 5: 8,878,870 (GRCm39) N751K possibly damaging Het
Akap13 G A 7: 75,380,213 (GRCm39) R462H probably damaging Het
Baz1a A T 12: 54,941,816 (GRCm39) Y1466* probably null Het
Ccng1 G A 11: 40,642,096 (GRCm39) H229Y probably benign Het
Cenpn C A 8: 117,663,976 (GRCm39) T256N probably benign Het
Ciart A G 3: 95,788,629 (GRCm39) V70A possibly damaging Het
Clcc1 A G 3: 108,568,774 (GRCm39) N36S probably damaging Het
Dmrt1 T A 19: 25,523,245 (GRCm39) S199T possibly damaging Het
Dmrt3 T C 19: 25,588,272 (GRCm39) V37A possibly damaging Het
Dock1 T A 7: 134,346,786 (GRCm39) D239E possibly damaging Het
Dyrk3 A G 1: 131,063,995 (GRCm39) probably null Het
Esyt1 T C 10: 128,347,354 (GRCm39) E1057G probably benign Het
Fsip2 A G 2: 82,818,793 (GRCm39) E4842G possibly damaging Het
Gadd45b G A 10: 80,766,984 (GRCm39) V90I probably benign Het
Gfi1 T A 5: 107,871,667 (GRCm39) H79L probably damaging Het
Golm2 T C 2: 121,737,242 (GRCm39) V261A probably benign Het
Idh2 T C 7: 79,748,001 (GRCm39) H233R probably benign Het
Itsn2 G A 12: 4,714,553 (GRCm39) A950T probably benign Het
Krtap5-4 C T 7: 141,857,671 (GRCm39) Q114* probably null Het
Loxl3 T C 6: 83,027,790 (GRCm39) F734S possibly damaging Het
Lpcat1 C T 13: 73,659,498 (GRCm39) T420I probably damaging Het
Lrch3 A T 16: 32,826,083 (GRCm39) D720V possibly damaging Het
Lrrk1 T C 7: 65,915,222 (GRCm39) D1622G possibly damaging Het
Meioc G C 11: 102,567,569 (GRCm39) A788P probably damaging Het
Mmp1a A T 9: 7,467,236 (GRCm39) T271S possibly damaging Het
Nrp2 C T 1: 62,784,567 (GRCm39) R239C probably damaging Het
Ntrk3 T A 7: 78,103,076 (GRCm39) D408V probably benign Het
Odf1 A G 15: 38,226,840 (GRCm39) I247V unknown Het
Or14j5 A T 17: 38,161,693 (GRCm39) D70V probably damaging Het
Or8k39 A G 2: 86,563,848 (GRCm39) L36P probably damaging Het
Pcsk1 T C 13: 75,274,958 (GRCm39) S516P probably benign Het
Phactr3 A C 2: 177,974,737 (GRCm39) R523S probably damaging Het
Pikfyve A G 1: 65,294,293 (GRCm39) D1411G probably damaging Het
Ppcs A T 4: 119,276,262 (GRCm39) S281T probably benign Het
Prkcg A G 7: 3,362,708 (GRCm39) D294G probably benign Het
Psg28 T A 7: 18,156,922 (GRCm39) I438L probably damaging Het
Pspc1 G A 14: 57,009,304 (GRCm39) Q177* probably null Het
Rbm33 G A 5: 28,599,606 (GRCm39) G185R Het
Rps6ka5 T C 12: 100,544,048 (GRCm39) E350G probably damaging Het
Satb2 A G 1: 56,910,917 (GRCm39) S243P probably benign Het
Serinc5 T C 13: 92,797,699 (GRCm39) probably null Het
Sgce T C 6: 4,691,636 (GRCm39) D313G probably damaging Het
Sntg1 C T 1: 8,433,794 (GRCm39) V486I probably damaging Het
Stxbp5 A G 10: 9,692,046 (GRCm39) V366A probably damaging Het
Tep1 A G 14: 51,061,687 (GRCm39) S2610P possibly damaging Het
Tlr3 G A 8: 45,853,819 (GRCm39) T167M not run Het
Tmem200a A G 10: 25,869,904 (GRCm39) S122P probably damaging Het
Tmprss15 C T 16: 78,887,751 (GRCm39) V19M probably damaging Het
Tnks2 T A 19: 36,829,901 (GRCm39) M194K probably benign Het
Trav14d-3-dv8 A C 14: 53,316,224 (GRCm39) Q28P probably damaging Het
Trpm5 T C 7: 142,634,106 (GRCm39) E700G probably benign Het
Ubqln3 T A 7: 103,791,797 (GRCm39) I98L probably benign Het
Uso1 A T 5: 92,314,439 (GRCm39) E115D probably benign Het
Vmn1r28 T C 6: 58,242,178 (GRCm39) V7A probably benign Het
Other mutations in Kcna5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02379:Kcna5 APN 6 126,511,472 (GRCm39) missense probably damaging 1.00
H8562:Kcna5 UTSW 6 126,510,386 (GRCm39) missense probably damaging 0.98
R0137:Kcna5 UTSW 6 126,510,346 (GRCm39) missense probably damaging 1.00
R0881:Kcna5 UTSW 6 126,511,957 (GRCm39) missense probably benign
R1436:Kcna5 UTSW 6 126,511,724 (GRCm39) missense probably damaging 0.99
R1561:Kcna5 UTSW 6 126,511,546 (GRCm39) missense probably damaging 1.00
R1730:Kcna5 UTSW 6 126,510,823 (GRCm39) missense probably damaging 1.00
R1783:Kcna5 UTSW 6 126,510,823 (GRCm39) missense probably damaging 1.00
R3940:Kcna5 UTSW 6 126,510,614 (GRCm39) missense probably damaging 1.00
R4276:Kcna5 UTSW 6 126,510,329 (GRCm39) missense probably damaging 1.00
R4372:Kcna5 UTSW 6 126,510,320 (GRCm39) makesense probably null
R4562:Kcna5 UTSW 6 126,511,303 (GRCm39) missense probably benign 0.00
R5130:Kcna5 UTSW 6 126,511,496 (GRCm39) missense probably benign 0.01
R5137:Kcna5 UTSW 6 126,510,946 (GRCm39) missense probably damaging 1.00
R5388:Kcna5 UTSW 6 126,511,859 (GRCm39) missense probably benign 0.04
R5890:Kcna5 UTSW 6 126,511,699 (GRCm39) missense probably damaging 1.00
R7159:Kcna5 UTSW 6 126,510,592 (GRCm39) missense probably damaging 1.00
R7162:Kcna5 UTSW 6 126,510,806 (GRCm39) missense possibly damaging 0.87
R7322:Kcna5 UTSW 6 126,510,754 (GRCm39) missense possibly damaging 0.83
R7353:Kcna5 UTSW 6 126,511,808 (GRCm39) missense probably benign 0.00
R7695:Kcna5 UTSW 6 126,511,174 (GRCm39) missense probably damaging 1.00
R7775:Kcna5 UTSW 6 126,511,768 (GRCm39) nonsense probably null
R7778:Kcna5 UTSW 6 126,511,768 (GRCm39) nonsense probably null
R7894:Kcna5 UTSW 6 126,512,011 (GRCm39) missense probably damaging 0.96
R7905:Kcna5 UTSW 6 126,511,831 (GRCm39) missense probably benign
R7961:Kcna5 UTSW 6 126,510,517 (GRCm39) missense probably benign
R8388:Kcna5 UTSW 6 126,511,588 (GRCm39) missense probably benign 0.08
R9725:Kcna5 UTSW 6 126,511,844 (GRCm39) missense probably benign
Z1176:Kcna5 UTSW 6 126,510,679 (GRCm39) missense probably damaging 1.00
Z1177:Kcna5 UTSW 6 126,510,953 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATCTGTTTCCCGGCTAGTG -3'
(R):5'- TATGACCACTGTAGGCTACGGG -3'

Sequencing Primer
(F):5'- CTAGTGTCCAGACAGAGGGCATAC -3'
(R):5'- GACATGAGGCCCATCACTGTAG -3'
Posted On 2020-01-23