Incidental Mutation 'R8009:Ubqln3'
ID 616804
Institutional Source Beutler Lab
Gene Symbol Ubqln3
Ensembl Gene ENSMUSG00000051618
Gene Name ubiquilin 3
Synonyms 4933400K24Rik
MMRRC Submission 046049-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.103) question?
Stock # R8009 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 103789830-103792486 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 103791797 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Leucine at position 98 (I98L)
Ref Sequence ENSEMBL: ENSMUSP00000055229 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057254]
AlphaFold Q8C5U9
Predicted Effect probably benign
Transcript: ENSMUST00000057254
AA Change: I98L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000055229
Gene: ENSMUSG00000051618
AA Change: I98L

DomainStartEndE-ValueType
UBQ 22 92 1.56e-15 SMART
low complexity region 103 115 N/A INTRINSIC
low complexity region 120 151 N/A INTRINSIC
STI1 194 233 4.25e-7 SMART
low complexity region 280 291 N/A INTRINSIC
low complexity region 313 328 N/A INTRINSIC
low complexity region 505 515 N/A INTRINSIC
UBA 619 657 4.22e-4 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (54/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ubiquitin-like protein (ubiquilin) that shares a high degree of similarity with related products in yeast, rat and frog. Ubiquilins contain an N-terminal ubiquitin-like domain and a C-terminal ubiquitin-associated domain. They physically associate with both proteasomes and ubiquitin ligases, and are thus thought to functionally link the ubiquitination machinery to the proteasome to affect in vivo protein degradation. This gene is specifically expressed in the testis. It has been suggested that this gene may regulate cell-cycle progression during spermatogenesis, however, it has been shown that the ortholgous mouse gene is dispensable for embryonic development and spermatogenesis. [provided by RefSeq, Nov 2016]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and developmentally normal with no apparent defects in male fertility or spermatogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1b T A 5: 8,878,870 (GRCm39) N751K possibly damaging Het
Akap13 G A 7: 75,380,213 (GRCm39) R462H probably damaging Het
Baz1a A T 12: 54,941,816 (GRCm39) Y1466* probably null Het
Ccng1 G A 11: 40,642,096 (GRCm39) H229Y probably benign Het
Cenpn C A 8: 117,663,976 (GRCm39) T256N probably benign Het
Ciart A G 3: 95,788,629 (GRCm39) V70A possibly damaging Het
Clcc1 A G 3: 108,568,774 (GRCm39) N36S probably damaging Het
Dmrt1 T A 19: 25,523,245 (GRCm39) S199T possibly damaging Het
Dmrt3 T C 19: 25,588,272 (GRCm39) V37A possibly damaging Het
Dock1 T A 7: 134,346,786 (GRCm39) D239E possibly damaging Het
Dyrk3 A G 1: 131,063,995 (GRCm39) probably null Het
Esyt1 T C 10: 128,347,354 (GRCm39) E1057G probably benign Het
Fsip2 A G 2: 82,818,793 (GRCm39) E4842G possibly damaging Het
Gadd45b G A 10: 80,766,984 (GRCm39) V90I probably benign Het
Gfi1 T A 5: 107,871,667 (GRCm39) H79L probably damaging Het
Golm2 T C 2: 121,737,242 (GRCm39) V261A probably benign Het
Idh2 T C 7: 79,748,001 (GRCm39) H233R probably benign Het
Itsn2 G A 12: 4,714,553 (GRCm39) A950T probably benign Het
Kcna5 A G 6: 126,510,517 (GRCm39) L537P probably benign Het
Krtap5-4 C T 7: 141,857,671 (GRCm39) Q114* probably null Het
Loxl3 T C 6: 83,027,790 (GRCm39) F734S possibly damaging Het
Lpcat1 C T 13: 73,659,498 (GRCm39) T420I probably damaging Het
Lrch3 A T 16: 32,826,083 (GRCm39) D720V possibly damaging Het
Lrrk1 T C 7: 65,915,222 (GRCm39) D1622G possibly damaging Het
Meioc G C 11: 102,567,569 (GRCm39) A788P probably damaging Het
Mmp1a A T 9: 7,467,236 (GRCm39) T271S possibly damaging Het
Nrp2 C T 1: 62,784,567 (GRCm39) R239C probably damaging Het
Ntrk3 T A 7: 78,103,076 (GRCm39) D408V probably benign Het
Odf1 A G 15: 38,226,840 (GRCm39) I247V unknown Het
Or14j5 A T 17: 38,161,693 (GRCm39) D70V probably damaging Het
Or8k39 A G 2: 86,563,848 (GRCm39) L36P probably damaging Het
Pcsk1 T C 13: 75,274,958 (GRCm39) S516P probably benign Het
Phactr3 A C 2: 177,974,737 (GRCm39) R523S probably damaging Het
Pikfyve A G 1: 65,294,293 (GRCm39) D1411G probably damaging Het
Ppcs A T 4: 119,276,262 (GRCm39) S281T probably benign Het
Prkcg A G 7: 3,362,708 (GRCm39) D294G probably benign Het
Psg28 T A 7: 18,156,922 (GRCm39) I438L probably damaging Het
Pspc1 G A 14: 57,009,304 (GRCm39) Q177* probably null Het
Rbm33 G A 5: 28,599,606 (GRCm39) G185R Het
Rps6ka5 T C 12: 100,544,048 (GRCm39) E350G probably damaging Het
Satb2 A G 1: 56,910,917 (GRCm39) S243P probably benign Het
Serinc5 T C 13: 92,797,699 (GRCm39) probably null Het
Sgce T C 6: 4,691,636 (GRCm39) D313G probably damaging Het
Sntg1 C T 1: 8,433,794 (GRCm39) V486I probably damaging Het
Stxbp5 A G 10: 9,692,046 (GRCm39) V366A probably damaging Het
Tep1 A G 14: 51,061,687 (GRCm39) S2610P possibly damaging Het
Tlr3 G A 8: 45,853,819 (GRCm39) T167M not run Het
Tmem200a A G 10: 25,869,904 (GRCm39) S122P probably damaging Het
Tmprss15 C T 16: 78,887,751 (GRCm39) V19M probably damaging Het
Tnks2 T A 19: 36,829,901 (GRCm39) M194K probably benign Het
Trav14d-3-dv8 A C 14: 53,316,224 (GRCm39) Q28P probably damaging Het
Trpm5 T C 7: 142,634,106 (GRCm39) E700G probably benign Het
Uso1 A T 5: 92,314,439 (GRCm39) E115D probably benign Het
Vmn1r28 T C 6: 58,242,178 (GRCm39) V7A probably benign Het
Other mutations in Ubqln3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00656:Ubqln3 APN 7 103,790,984 (GRCm39) missense probably benign 0.00
IGL00766:Ubqln3 APN 7 103,792,031 (GRCm39) missense probably benign 0.00
IGL01451:Ubqln3 APN 7 103,791,403 (GRCm39) missense possibly damaging 0.71
IGL01673:Ubqln3 APN 7 103,791,605 (GRCm39) missense probably benign 0.12
IGL01705:Ubqln3 APN 7 103,791,884 (GRCm39) missense probably damaging 1.00
IGL01988:Ubqln3 APN 7 103,792,089 (GRCm39) utr 5 prime probably benign
IGL02008:Ubqln3 APN 7 103,791,523 (GRCm39) missense probably damaging 1.00
IGL02072:Ubqln3 APN 7 103,790,506 (GRCm39) missense possibly damaging 0.69
IGL02546:Ubqln3 APN 7 103,791,725 (GRCm39) missense probably benign 0.02
IGL02657:Ubqln3 APN 7 103,791,170 (GRCm39) missense probably damaging 0.97
IGL02682:Ubqln3 APN 7 103,791,272 (GRCm39) missense probably benign 0.19
IGL02709:Ubqln3 APN 7 103,790,543 (GRCm39) missense probably benign 0.12
IGL03357:Ubqln3 APN 7 103,791,763 (GRCm39) missense probably benign
PIT4544001:Ubqln3 UTSW 7 103,790,550 (GRCm39) missense probably damaging 0.97
R0180:Ubqln3 UTSW 7 103,791,047 (GRCm39) missense probably damaging 1.00
R0845:Ubqln3 UTSW 7 103,791,275 (GRCm39) missense probably damaging 0.98
R1019:Ubqln3 UTSW 7 103,790,593 (GRCm39) missense probably benign 0.00
R1280:Ubqln3 UTSW 7 103,791,283 (GRCm39) missense possibly damaging 0.85
R1448:Ubqln3 UTSW 7 103,791,997 (GRCm39) missense probably damaging 1.00
R1550:Ubqln3 UTSW 7 103,790,753 (GRCm39) missense probably damaging 0.98
R1617:Ubqln3 UTSW 7 103,792,067 (GRCm39) missense possibly damaging 0.95
R1650:Ubqln3 UTSW 7 103,790,228 (GRCm39) missense possibly damaging 0.84
R2060:Ubqln3 UTSW 7 103,791,358 (GRCm39) missense probably damaging 1.00
R2246:Ubqln3 UTSW 7 103,791,518 (GRCm39) missense probably damaging 1.00
R2263:Ubqln3 UTSW 7 103,790,842 (GRCm39) nonsense probably null
R2366:Ubqln3 UTSW 7 103,790,256 (GRCm39) missense probably damaging 0.99
R4232:Ubqln3 UTSW 7 103,791,010 (GRCm39) missense probably benign 0.00
R4447:Ubqln3 UTSW 7 103,792,021 (GRCm39) missense probably benign 0.31
R4509:Ubqln3 UTSW 7 103,790,651 (GRCm39) missense probably damaging 0.97
R4604:Ubqln3 UTSW 7 103,791,698 (GRCm39) missense probably benign 0.00
R5416:Ubqln3 UTSW 7 103,790,879 (GRCm39) missense probably benign 0.34
R5617:Ubqln3 UTSW 7 103,791,640 (GRCm39) missense probably damaging 0.99
R5648:Ubqln3 UTSW 7 103,790,117 (GRCm39) missense probably damaging 0.99
R5722:Ubqln3 UTSW 7 103,790,674 (GRCm39) missense probably benign 0.00
R5723:Ubqln3 UTSW 7 103,790,674 (GRCm39) missense probably benign 0.00
R5724:Ubqln3 UTSW 7 103,790,674 (GRCm39) missense probably benign 0.00
R5819:Ubqln3 UTSW 7 103,790,674 (GRCm39) missense probably benign 0.00
R5820:Ubqln3 UTSW 7 103,790,674 (GRCm39) missense probably benign 0.00
R5966:Ubqln3 UTSW 7 103,790,906 (GRCm39) missense probably benign 0.03
R6260:Ubqln3 UTSW 7 103,791,524 (GRCm39) nonsense probably null
R6272:Ubqln3 UTSW 7 103,791,385 (GRCm39) missense probably damaging 1.00
R6542:Ubqln3 UTSW 7 103,790,824 (GRCm39) missense probably benign 0.00
R6936:Ubqln3 UTSW 7 103,791,517 (GRCm39) missense probably damaging 1.00
R7023:Ubqln3 UTSW 7 103,790,630 (GRCm39) missense probably damaging 1.00
R7025:Ubqln3 UTSW 7 103,790,482 (GRCm39) missense probably benign 0.01
R7079:Ubqln3 UTSW 7 103,790,578 (GRCm39) missense probably benign 0.12
R7733:Ubqln3 UTSW 7 103,790,283 (GRCm39) missense probably damaging 0.98
R7764:Ubqln3 UTSW 7 103,790,443 (GRCm39) missense possibly damaging 0.52
R7919:Ubqln3 UTSW 7 103,790,399 (GRCm39) missense probably benign 0.03
R7961:Ubqln3 UTSW 7 103,791,797 (GRCm39) missense probably benign 0.00
R9619:Ubqln3 UTSW 7 103,791,053 (GRCm39) missense probably benign 0.05
R9652:Ubqln3 UTSW 7 103,791,962 (GRCm39) missense probably damaging 1.00
RF054:Ubqln3 UTSW 7 103,790,385 (GRCm39) frame shift probably null
Predicted Primers PCR Primer
(F):5'- AACGAGCTGAGCCACAAGTTC -3'
(R):5'- TTGTAGACACATGCACCATCCG -3'

Sequencing Primer
(F):5'- ACTGAGATGTGCTGCCAC -3'
(R):5'- CCATCCGGCAGCTAAAGG -3'
Posted On 2020-01-23