Incidental Mutation 'R8009:Tmem200a'
ID616812
Institutional Source Beutler Lab
Gene Symbol Tmem200a
Ensembl Gene ENSMUSG00000049420
Gene Nametransmembrane protein 200A
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #R8009 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location25912331-26079052 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 25994006 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 122 (S122P)
Ref Sequence ENSEMBL: ENSMUSP00000064080 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066049] [ENSMUST00000218232] [ENSMUST00000219338] [ENSMUST00000219651] [ENSMUST00000219872]
Predicted Effect probably damaging
Transcript: ENSMUST00000066049
AA Change: S122P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000064080
Gene: ENSMUSG00000049420
AA Change: S122P

DomainStartEndE-ValueType
Pfam:DUF2371 16 161 8.9e-62 PFAM
low complexity region 262 279 N/A INTRINSIC
low complexity region 387 401 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000218232
AA Change: S122P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000219338
AA Change: S122P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000219651
AA Change: S122P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably benign
Transcript: ENSMUST00000219872
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1b T A 5: 8,828,870 N751K possibly damaging Het
Akap13 G A 7: 75,730,465 R462H probably damaging Het
Baz1a A T 12: 54,895,031 Y1466* probably null Het
Casc4 T C 2: 121,906,761 V261A probably benign Het
Ccng1 G A 11: 40,751,269 H229Y probably benign Het
Cenpn C A 8: 116,937,237 T256N probably benign Het
Ciart A G 3: 95,881,317 V70A possibly damaging Het
Clcc1 A G 3: 108,661,458 N36S probably damaging Het
Dmrt1 T A 19: 25,545,881 S199T possibly damaging Het
Dmrt3 T C 19: 25,610,908 V37A possibly damaging Het
Dock1 T A 7: 134,745,057 D239E possibly damaging Het
Dyrk3 A G 1: 131,136,258 probably null Het
Esyt1 T C 10: 128,511,485 E1057G probably benign Het
Fsip2 A G 2: 82,988,449 E4842G possibly damaging Het
Gadd45b G A 10: 80,931,150 V90I probably benign Het
Gfi1 T A 5: 107,723,801 H79L probably damaging Het
Idh2 T C 7: 80,098,253 H233R probably benign Het
Itsn2 G A 12: 4,664,553 A950T probably benign Het
Kcna5 A G 6: 126,533,554 L537P probably benign Het
Krtap5-4 C T 7: 142,303,934 Q114* probably null Het
Loxl3 T C 6: 83,050,809 F734S possibly damaging Het
Lpcat1 C T 13: 73,511,379 T420I probably damaging Het
Lrch3 A T 16: 33,005,713 D720V possibly damaging Het
Lrrk1 T C 7: 66,265,474 D1622G possibly damaging Het
Meioc G C 11: 102,676,743 A788P probably damaging Het
Mmp1a A T 9: 7,467,235 T271S possibly damaging Het
Nrp2 C T 1: 62,745,408 R239C probably damaging Het
Ntrk3 T A 7: 78,453,328 D408V probably benign Het
Odf1 A G 15: 38,226,596 I247V unknown Het
Olfr1089 A G 2: 86,733,504 L36P probably damaging Het
Olfr126 A T 17: 37,850,802 D70V probably damaging Het
Pcsk1 T C 13: 75,126,839 S516P probably benign Het
Phactr3 A C 2: 178,332,944 R523S probably damaging Het
Pikfyve A G 1: 65,255,134 D1411G probably damaging Het
Ppcs A T 4: 119,419,065 S281T probably benign Het
Prkcg A G 7: 3,314,192 D294G probably benign Het
Psg28 T A 7: 18,422,997 I438L probably damaging Het
Pspc1 G A 14: 56,771,847 Q177* probably null Het
Rbm33 G A 5: 28,394,608 G185R Het
Rps6ka5 T C 12: 100,577,789 E350G probably damaging Het
Satb2 A G 1: 56,871,758 S243P probably benign Het
Sgce T C 6: 4,691,636 D313G probably damaging Het
Sntg1 C T 1: 8,363,570 V486I probably damaging Het
Stxbp5 A G 10: 9,816,302 V366A probably damaging Het
Tep1 A G 14: 50,824,230 S2610P possibly damaging Het
Tlr3 G A 8: 45,400,782 T167M not run Het
Tmprss15 C T 16: 79,090,863 V19M probably damaging Het
Tnks2 T A 19: 36,852,501 M194K probably benign Het
Trav14d-3-dv8 A C 14: 53,078,767 Q28P probably damaging Het
Trpm5 T C 7: 143,080,369 E700G probably benign Het
Ubqln3 T A 7: 104,142,590 I98L probably benign Het
Uso1 A T 5: 92,166,580 E115D probably benign Het
Vmn1r28 T C 6: 58,265,193 V7A probably benign Het
Other mutations in Tmem200a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01098:Tmem200a APN 10 25994143 missense probably damaging 0.98
IGL02323:Tmem200a APN 10 25993430 missense probably benign 0.12
IGL02702:Tmem200a APN 10 25993603 missense probably damaging 1.00
IGL03221:Tmem200a APN 10 25994024 missense possibly damaging 0.54
R0467:Tmem200a UTSW 10 25994104 missense probably benign 0.09
R1169:Tmem200a UTSW 10 25994348 missense probably damaging 1.00
R1543:Tmem200a UTSW 10 26078620 unclassified probably benign
R1555:Tmem200a UTSW 10 25993884 missense probably damaging 1.00
R1630:Tmem200a UTSW 10 25992914 missense probably damaging 1.00
R1693:Tmem200a UTSW 10 25993979 missense possibly damaging 0.94
R1786:Tmem200a UTSW 10 25993927 missense probably damaging 1.00
R1891:Tmem200a UTSW 10 25994072 missense probably damaging 1.00
R2113:Tmem200a UTSW 10 25993322 missense probably damaging 1.00
R2260:Tmem200a UTSW 10 25993415 missense probably benign
R3793:Tmem200a UTSW 10 25994189 missense probably damaging 1.00
R5062:Tmem200a UTSW 10 25993915 missense probably damaging 1.00
R5178:Tmem200a UTSW 10 25994379 missense probably benign 0.02
R5195:Tmem200a UTSW 10 26078956 unclassified probably benign
R5208:Tmem200a UTSW 10 25994153 missense probably benign 0.00
R6045:Tmem200a UTSW 10 25993007 missense probably damaging 1.00
R6319:Tmem200a UTSW 10 25993495 missense probably damaging 1.00
R6552:Tmem200a UTSW 10 25993483 missense probably damaging 1.00
R7797:Tmem200a UTSW 10 25993966 missense possibly damaging 0.95
R8074:Tmem200a UTSW 10 25992952 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCTCCTTGAGTCTCAGAGTG -3'
(R):5'- CACGAGCAGATGTTGTGGTG -3'

Sequencing Primer
(F):5'- CTCAGAGTGTGGATGTCGATGAC -3'
(R):5'- GTCCGTGGGAAAATCCGACTTTATTC -3'
Posted On2020-01-23