Incidental Mutation 'R8009:Meioc'
ID 616816
Institutional Source Beutler Lab
Gene Symbol Meioc
Ensembl Gene ENSMUSG00000051455
Gene Name meiosis specific with coiled-coil domain
Synonyms LOC380729, LOC268491, Gm1564
MMRRC Submission 046049-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.117) question?
Stock # R8009 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 102556177-102573066 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to C at 102567569 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Alanine to Proline at position 788 (A788P)
Ref Sequence ENSEMBL: ENSMUSP00000097947 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100378] [ENSMUST00000156590]
AlphaFold A2AG06
Predicted Effect probably damaging
Transcript: ENSMUST00000100378
AA Change: A788P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000097947
Gene: ENSMUSG00000051455
AA Change: A788P

DomainStartEndE-ValueType
low complexity region 526 537 N/A INTRINSIC
low complexity region 712 728 N/A INTRINSIC
Pfam:DUF4582 757 922 5.1e-89 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000156590
SMART Domains Protein: ENSMUSP00000116246
Gene: ENSMUSG00000051455

DomainStartEndE-ValueType
low complexity region 470 481 N/A INTRINSIC
Meta Mutation Damage Score 0.2518 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (54/54)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit infertility with small gonads, absent germ cells and arrested meiosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1b T A 5: 8,878,870 (GRCm39) N751K possibly damaging Het
Akap13 G A 7: 75,380,213 (GRCm39) R462H probably damaging Het
Baz1a A T 12: 54,941,816 (GRCm39) Y1466* probably null Het
Ccng1 G A 11: 40,642,096 (GRCm39) H229Y probably benign Het
Cenpn C A 8: 117,663,976 (GRCm39) T256N probably benign Het
Ciart A G 3: 95,788,629 (GRCm39) V70A possibly damaging Het
Clcc1 A G 3: 108,568,774 (GRCm39) N36S probably damaging Het
Dmrt1 T A 19: 25,523,245 (GRCm39) S199T possibly damaging Het
Dmrt3 T C 19: 25,588,272 (GRCm39) V37A possibly damaging Het
Dock1 T A 7: 134,346,786 (GRCm39) D239E possibly damaging Het
Dyrk3 A G 1: 131,063,995 (GRCm39) probably null Het
Esyt1 T C 10: 128,347,354 (GRCm39) E1057G probably benign Het
Fsip2 A G 2: 82,818,793 (GRCm39) E4842G possibly damaging Het
Gadd45b G A 10: 80,766,984 (GRCm39) V90I probably benign Het
Gfi1 T A 5: 107,871,667 (GRCm39) H79L probably damaging Het
Golm2 T C 2: 121,737,242 (GRCm39) V261A probably benign Het
Idh2 T C 7: 79,748,001 (GRCm39) H233R probably benign Het
Itsn2 G A 12: 4,714,553 (GRCm39) A950T probably benign Het
Kcna5 A G 6: 126,510,517 (GRCm39) L537P probably benign Het
Krtap5-4 C T 7: 141,857,671 (GRCm39) Q114* probably null Het
Loxl3 T C 6: 83,027,790 (GRCm39) F734S possibly damaging Het
Lpcat1 C T 13: 73,659,498 (GRCm39) T420I probably damaging Het
Lrch3 A T 16: 32,826,083 (GRCm39) D720V possibly damaging Het
Lrrk1 T C 7: 65,915,222 (GRCm39) D1622G possibly damaging Het
Mmp1a A T 9: 7,467,236 (GRCm39) T271S possibly damaging Het
Nrp2 C T 1: 62,784,567 (GRCm39) R239C probably damaging Het
Ntrk3 T A 7: 78,103,076 (GRCm39) D408V probably benign Het
Odf1 A G 15: 38,226,840 (GRCm39) I247V unknown Het
Or14j5 A T 17: 38,161,693 (GRCm39) D70V probably damaging Het
Or8k39 A G 2: 86,563,848 (GRCm39) L36P probably damaging Het
Pcsk1 T C 13: 75,274,958 (GRCm39) S516P probably benign Het
Phactr3 A C 2: 177,974,737 (GRCm39) R523S probably damaging Het
Pikfyve A G 1: 65,294,293 (GRCm39) D1411G probably damaging Het
Ppcs A T 4: 119,276,262 (GRCm39) S281T probably benign Het
Prkcg A G 7: 3,362,708 (GRCm39) D294G probably benign Het
Psg28 T A 7: 18,156,922 (GRCm39) I438L probably damaging Het
Pspc1 G A 14: 57,009,304 (GRCm39) Q177* probably null Het
Rbm33 G A 5: 28,599,606 (GRCm39) G185R Het
Rps6ka5 T C 12: 100,544,048 (GRCm39) E350G probably damaging Het
Satb2 A G 1: 56,910,917 (GRCm39) S243P probably benign Het
Serinc5 T C 13: 92,797,699 (GRCm39) probably null Het
Sgce T C 6: 4,691,636 (GRCm39) D313G probably damaging Het
Sntg1 C T 1: 8,433,794 (GRCm39) V486I probably damaging Het
Stxbp5 A G 10: 9,692,046 (GRCm39) V366A probably damaging Het
Tep1 A G 14: 51,061,687 (GRCm39) S2610P possibly damaging Het
Tlr3 G A 8: 45,853,819 (GRCm39) T167M not run Het
Tmem200a A G 10: 25,869,904 (GRCm39) S122P probably damaging Het
Tmprss15 C T 16: 78,887,751 (GRCm39) V19M probably damaging Het
Tnks2 T A 19: 36,829,901 (GRCm39) M194K probably benign Het
Trav14d-3-dv8 A C 14: 53,316,224 (GRCm39) Q28P probably damaging Het
Trpm5 T C 7: 142,634,106 (GRCm39) E700G probably benign Het
Ubqln3 T A 7: 103,791,797 (GRCm39) I98L probably benign Het
Uso1 A T 5: 92,314,439 (GRCm39) E115D probably benign Het
Vmn1r28 T C 6: 58,242,178 (GRCm39) V7A probably benign Het
Other mutations in Meioc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01391:Meioc APN 11 102,565,113 (GRCm39) missense probably benign 0.33
IGL01952:Meioc APN 11 102,563,011 (GRCm39) missense possibly damaging 0.79
IGL02006:Meioc APN 11 102,565,092 (GRCm39) missense probably damaging 1.00
IGL02195:Meioc APN 11 102,565,683 (GRCm39) missense possibly damaging 0.91
IGL02339:Meioc APN 11 102,559,274 (GRCm39) missense probably benign 0.18
IGL02935:Meioc APN 11 102,563,017 (GRCm39) missense probably benign 0.06
IGL03294:Meioc APN 11 102,571,495 (GRCm39) missense probably damaging 1.00
PIT4519001:Meioc UTSW 11 102,570,783 (GRCm39) missense probably damaging 1.00
R0285:Meioc UTSW 11 102,563,017 (GRCm39) missense probably benign 0.06
R0964:Meioc UTSW 11 102,570,857 (GRCm39) missense probably damaging 1.00
R1074:Meioc UTSW 11 102,566,219 (GRCm39) missense probably damaging 1.00
R2024:Meioc UTSW 11 102,566,184 (GRCm39) missense probably benign 0.00
R4012:Meioc UTSW 11 102,566,654 (GRCm39) missense probably damaging 0.99
R4429:Meioc UTSW 11 102,566,546 (GRCm39) missense probably damaging 1.00
R4491:Meioc UTSW 11 102,565,746 (GRCm39) missense possibly damaging 0.84
R4594:Meioc UTSW 11 102,564,992 (GRCm39) missense probably damaging 1.00
R4752:Meioc UTSW 11 102,565,259 (GRCm39) missense probably benign 0.00
R5301:Meioc UTSW 11 102,570,871 (GRCm39) missense probably damaging 1.00
R5352:Meioc UTSW 11 102,566,139 (GRCm39) missense probably benign 0.03
R5646:Meioc UTSW 11 102,566,083 (GRCm39) missense possibly damaging 0.94
R5958:Meioc UTSW 11 102,565,979 (GRCm39) missense probably benign 0.41
R5968:Meioc UTSW 11 102,566,657 (GRCm39) missense probably damaging 0.99
R6157:Meioc UTSW 11 102,559,227 (GRCm39) missense probably damaging 1.00
R6410:Meioc UTSW 11 102,565,860 (GRCm39) missense probably benign 0.00
R6644:Meioc UTSW 11 102,559,286 (GRCm39) critical splice donor site probably null
R7285:Meioc UTSW 11 102,557,168 (GRCm39) missense probably benign 0.00
R7440:Meioc UTSW 11 102,565,063 (GRCm39) missense possibly damaging 0.67
R7815:Meioc UTSW 11 102,566,414 (GRCm39) missense probably damaging 1.00
R7984:Meioc UTSW 11 102,565,432 (GRCm39) missense possibly damaging 0.94
R8078:Meioc UTSW 11 102,559,226 (GRCm39) nonsense probably null
R8195:Meioc UTSW 11 102,565,893 (GRCm39) nonsense probably null
R8429:Meioc UTSW 11 102,565,032 (GRCm39) missense probably benign 0.06
R8797:Meioc UTSW 11 102,567,686 (GRCm39) nonsense probably null
R8854:Meioc UTSW 11 102,566,589 (GRCm39) missense probably damaging 0.98
R8891:Meioc UTSW 11 102,559,246 (GRCm39) missense probably benign 0.43
R9081:Meioc UTSW 11 102,565,001 (GRCm39) missense probably benign 0.00
R9360:Meioc UTSW 11 102,565,779 (GRCm39) missense probably benign 0.13
R9539:Meioc UTSW 11 102,565,506 (GRCm39) missense probably damaging 0.99
R9549:Meioc UTSW 11 102,556,550 (GRCm39) intron probably benign
R9751:Meioc UTSW 11 102,566,419 (GRCm39) nonsense probably null
Z1177:Meioc UTSW 11 102,557,190 (GRCm39) frame shift probably null
Predicted Primers PCR Primer
(F):5'- TTCTTCCTTATTGGTTTACAGAAGTT -3'
(R):5'- TACGACTCTAGCTTACTGAAATTCTTT -3'

Sequencing Primer
(F):5'- GGTTGCCTTTTGACACCA -3'
(R):5'- CTGGCTTGTTCTCGAAGT -3'
Posted On 2020-01-23