Incidental Mutation 'R8009:Baz1a'
ID616818
Institutional Source Beutler Lab
Gene Symbol Baz1a
Ensembl Gene ENSMUSG00000035021
Gene Namebromodomain adjacent to zinc finger domain 1A
SynonymsWcrf180, Acf1, Gtl5
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8009 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location54892989-55014348 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 54895031 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 1466 (Y1466*)
Ref Sequence ENSEMBL: ENSMUSP00000039757 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038926] [ENSMUST00000173433]
Predicted Effect probably null
Transcript: ENSMUST00000038926
AA Change: Y1466*
SMART Domains Protein: ENSMUSP00000039757
Gene: ENSMUSG00000035021
AA Change: Y1466*

DomainStartEndE-ValueType
Pfam:WAC_Acf1_DNA_bd 23 122 4.4e-36 PFAM
low complexity region 164 175 N/A INTRINSIC
coiled coil region 312 397 N/A INTRINSIC
Pfam:DDT 423 485 2.3e-14 PFAM
low complexity region 519 530 N/A INTRINSIC
Pfam:WHIM1 593 641 1.5e-8 PFAM
low complexity region 658 696 N/A INTRINSIC
low complexity region 725 738 N/A INTRINSIC
low complexity region 774 796 N/A INTRINSIC
low complexity region 861 873 N/A INTRINSIC
Pfam:WHIM3 894 932 2e-16 PFAM
low complexity region 1058 1073 N/A INTRINSIC
PHD 1151 1197 9.46e-15 SMART
RING 1152 1196 6.88e-1 SMART
low complexity region 1214 1257 N/A INTRINSIC
BROMO 1426 1534 2.18e-31 SMART
Predicted Effect probably null
Transcript: ENSMUST00000173433
AA Change: Y1463*
SMART Domains Protein: ENSMUSP00000133478
Gene: ENSMUSG00000035021
AA Change: Y1463*

DomainStartEndE-ValueType
Pfam:WAC_Acf1_DNA_bd 22 122 1.1e-37 PFAM
low complexity region 164 175 N/A INTRINSIC
coiled coil region 312 397 N/A INTRINSIC
DDT 422 487 1.54e-19 SMART
low complexity region 518 529 N/A INTRINSIC
Pfam:WHIM1 592 640 1.8e-8 PFAM
low complexity region 657 695 N/A INTRINSIC
low complexity region 722 735 N/A INTRINSIC
low complexity region 771 793 N/A INTRINSIC
low complexity region 858 870 N/A INTRINSIC
low complexity region 1055 1070 N/A INTRINSIC
PHD 1148 1194 9.46e-15 SMART
RING 1149 1193 6.88e-1 SMART
low complexity region 1211 1254 N/A INTRINSIC
BROMO 1423 1531 2.18e-31 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The BAZ1A gene encodes the accessory subunit of the ATP-dependent chromatin assembly factor (ACF), a member of the ISWI ('imitation switch') family of chromatin remodeling complexes (summarized by Racki et al., 2009 [PubMed 20033039]).[supplied by OMIM, Apr 2010]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and able to repair meiotic double-strand breaks but exhibit teratospermia, oligospermia, asthenospermia, and male infertility due to impaired spermiogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1b T A 5: 8,828,870 N751K possibly damaging Het
Akap13 G A 7: 75,730,465 R462H probably damaging Het
Casc4 T C 2: 121,906,761 V261A probably benign Het
Ccng1 G A 11: 40,751,269 H229Y probably benign Het
Cenpn C A 8: 116,937,237 T256N probably benign Het
Ciart A G 3: 95,881,317 V70A possibly damaging Het
Clcc1 A G 3: 108,661,458 N36S probably damaging Het
Dmrt1 T A 19: 25,545,881 S199T possibly damaging Het
Dmrt3 T C 19: 25,610,908 V37A possibly damaging Het
Dock1 T A 7: 134,745,057 D239E possibly damaging Het
Dyrk3 A G 1: 131,136,258 probably null Het
Esyt1 T C 10: 128,511,485 E1057G probably benign Het
Fsip2 A G 2: 82,988,449 E4842G possibly damaging Het
Gadd45b G A 10: 80,931,150 V90I probably benign Het
Gfi1 T A 5: 107,723,801 H79L probably damaging Het
Idh2 T C 7: 80,098,253 H233R probably benign Het
Itsn2 G A 12: 4,664,553 A950T probably benign Het
Kcna5 A G 6: 126,533,554 L537P probably benign Het
Krtap5-4 C T 7: 142,303,934 Q114* probably null Het
Loxl3 T C 6: 83,050,809 F734S possibly damaging Het
Lpcat1 C T 13: 73,511,379 T420I probably damaging Het
Lrch3 A T 16: 33,005,713 D720V possibly damaging Het
Lrrk1 T C 7: 66,265,474 D1622G possibly damaging Het
Meioc G C 11: 102,676,743 A788P probably damaging Het
Mmp1a A T 9: 7,467,235 T271S possibly damaging Het
Nrp2 C T 1: 62,745,408 R239C probably damaging Het
Ntrk3 T A 7: 78,453,328 D408V probably benign Het
Odf1 A G 15: 38,226,596 I247V unknown Het
Olfr1089 A G 2: 86,733,504 L36P probably damaging Het
Olfr126 A T 17: 37,850,802 D70V probably damaging Het
Pcsk1 T C 13: 75,126,839 S516P probably benign Het
Phactr3 A C 2: 178,332,944 R523S probably damaging Het
Pikfyve A G 1: 65,255,134 D1411G probably damaging Het
Ppcs A T 4: 119,419,065 S281T probably benign Het
Prkcg A G 7: 3,314,192 D294G probably benign Het
Psg28 T A 7: 18,422,997 I438L probably damaging Het
Pspc1 G A 14: 56,771,847 Q177* probably null Het
Rbm33 G A 5: 28,394,608 G185R Het
Rps6ka5 T C 12: 100,577,789 E350G probably damaging Het
Satb2 A G 1: 56,871,758 S243P probably benign Het
Sgce T C 6: 4,691,636 D313G probably damaging Het
Sntg1 C T 1: 8,363,570 V486I probably damaging Het
Stxbp5 A G 10: 9,816,302 V366A probably damaging Het
Tep1 A G 14: 50,824,230 S2610P possibly damaging Het
Tlr3 G A 8: 45,400,782 T167M not run Het
Tmem200a A G 10: 25,994,006 S122P probably damaging Het
Tmprss15 C T 16: 79,090,863 V19M probably damaging Het
Tnks2 T A 19: 36,852,501 M194K probably benign Het
Trav14d-3-dv8 A C 14: 53,078,767 Q28P probably damaging Het
Trpm5 T C 7: 143,080,369 E700G probably benign Het
Ubqln3 T A 7: 104,142,590 I98L probably benign Het
Uso1 A T 5: 92,166,580 E115D probably benign Het
Vmn1r28 T C 6: 58,265,193 V7A probably benign Het
Other mutations in Baz1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01108:Baz1a APN 12 54916731 missense probably benign
IGL01138:Baz1a APN 12 54930325 missense probably damaging 1.00
IGL01298:Baz1a APN 12 54954809 missense probably damaging 1.00
IGL02639:Baz1a APN 12 54896025 splice site probably benign
IGL02995:Baz1a APN 12 54900447 missense probably damaging 1.00
IGL03001:Baz1a APN 12 54923111 missense possibly damaging 0.50
IGL03104:Baz1a APN 12 54894958 missense probably damaging 1.00
IGL03135:Baz1a APN 12 54929590 missense probably damaging 1.00
IGL03151:Baz1a APN 12 54909149 critical splice acceptor site probably null
IGL03235:Baz1a APN 12 54898535 missense probably damaging 1.00
IGL03240:Baz1a APN 12 54927567 nonsense probably null
Flavia UTSW 12 54975308 missense probably damaging 1.00
gumdrops UTSW 12 54900448 missense probably damaging 1.00
Kilter UTSW 12 54900532 missense probably damaging 0.99
Kisses UTSW 12 54975137 missense probably damaging 1.00
Smootch UTSW 12 54911385 missense probably damaging 1.00
PIT4458001:Baz1a UTSW 12 54930310 missense probably benign 0.03
R0127:Baz1a UTSW 12 54898706 missense possibly damaging 0.93
R0183:Baz1a UTSW 12 54911387 missense probably damaging 1.00
R0393:Baz1a UTSW 12 54918436 critical splice donor site probably null
R0532:Baz1a UTSW 12 54934820 missense possibly damaging 0.55
R0614:Baz1a UTSW 12 54941519 nonsense probably null
R0626:Baz1a UTSW 12 54975270 missense probably damaging 0.99
R0654:Baz1a UTSW 12 54911397 missense probably benign 0.01
R0782:Baz1a UTSW 12 54894488 missense probably damaging 1.00
R0826:Baz1a UTSW 12 54930312 nonsense probably null
R0855:Baz1a UTSW 12 54900563 splice site probably benign
R0927:Baz1a UTSW 12 54894988 missense probably damaging 1.00
R0941:Baz1a UTSW 12 54898431 missense probably benign 0.00
R1079:Baz1a UTSW 12 54895000 missense possibly damaging 0.91
R1157:Baz1a UTSW 12 54929564 missense probably damaging 1.00
R1647:Baz1a UTSW 12 54975198 missense probably damaging 1.00
R1731:Baz1a UTSW 12 54918545 missense possibly damaging 0.83
R1739:Baz1a UTSW 12 54898788 nonsense probably null
R1762:Baz1a UTSW 12 54909020 missense probably damaging 1.00
R1770:Baz1a UTSW 12 54898508 missense probably damaging 1.00
R1968:Baz1a UTSW 12 54900337 missense possibly damaging 0.91
R2037:Baz1a UTSW 12 54929646 missense probably damaging 1.00
R2111:Baz1a UTSW 12 54911385 missense probably damaging 1.00
R2215:Baz1a UTSW 12 54975369 nonsense probably null
R2282:Baz1a UTSW 12 54916812 nonsense probably null
R2875:Baz1a UTSW 12 54923119 missense probably damaging 1.00
R2890:Baz1a UTSW 12 54898517 missense probably benign
R2971:Baz1a UTSW 12 54923439 missense probably damaging 1.00
R3404:Baz1a UTSW 12 54916989 missense probably benign 0.00
R3419:Baz1a UTSW 12 54946899 missense probably benign 0.05
R3699:Baz1a UTSW 12 54917046 missense probably benign 0.09
R3899:Baz1a UTSW 12 54934804 missense probably benign 0.01
R3927:Baz1a UTSW 12 54921143 missense possibly damaging 0.68
R4050:Baz1a UTSW 12 54929619 missense probably benign 0.00
R4072:Baz1a UTSW 12 54941560 missense probably benign 0.18
R4196:Baz1a UTSW 12 54911415 missense probably damaging 1.00
R4289:Baz1a UTSW 12 54900448 missense probably damaging 1.00
R4455:Baz1a UTSW 12 54911368 missense probably benign 0.26
R4583:Baz1a UTSW 12 54922540 missense probably damaging 0.99
R4622:Baz1a UTSW 12 54941515 missense probably benign 0.00
R4807:Baz1a UTSW 12 54898482 missense probably benign 0.28
R4998:Baz1a UTSW 12 54975137 missense probably damaging 1.00
R5239:Baz1a UTSW 12 54898344 missense probably damaging 0.99
R5379:Baz1a UTSW 12 54894348 missense probably damaging 1.00
R5408:Baz1a UTSW 12 54923050 missense probably damaging 1.00
R5678:Baz1a UTSW 12 54900532 missense probably damaging 0.99
R5810:Baz1a UTSW 12 54927715 intron probably benign
R6092:Baz1a UTSW 12 54909083 missense possibly damaging 0.88
R6317:Baz1a UTSW 12 54954800 missense possibly damaging 0.92
R6332:Baz1a UTSW 12 54918554 missense probably benign 0.01
R6803:Baz1a UTSW 12 54941555 missense probably null 0.99
R7185:Baz1a UTSW 12 54975308 missense probably damaging 1.00
R7248:Baz1a UTSW 12 54900508 missense probably damaging 1.00
R7392:Baz1a UTSW 12 54898765 missense probably damaging 1.00
R8025:Baz1a UTSW 12 54909136 missense probably benign 0.34
Predicted Primers PCR Primer
(F):5'- AATGAGCATTTGAGGAACCTCC -3'
(R):5'- ATTGCCCTGAATTCCAGCC -3'

Sequencing Primer
(F):5'- ACCTCCTGGGCTGCCAAAC -3'
(R):5'- ATTGCCCTGAATTCCAGCCTTTATC -3'
Posted On2020-01-23