Incidental Mutation 'R8009:Baz1a'
ID 616818
Institutional Source Beutler Lab
Gene Symbol Baz1a
Ensembl Gene ENSMUSG00000035021
Gene Name bromodomain adjacent to zinc finger domain 1A
Synonyms Gtl5, Wcrf180, Acf1
MMRRC Submission 046049-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8009 (G1)
Quality Score 225.009
Status Validated
Chromosome 12
Chromosomal Location 54939774-55061133 bp(-) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) A to T at 54941816 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Stop codon at position 1466 (Y1466*)
Ref Sequence ENSEMBL: ENSMUSP00000039757 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038926] [ENSMUST00000173433]
AlphaFold O88379
Predicted Effect probably null
Transcript: ENSMUST00000038926
AA Change: Y1466*
SMART Domains Protein: ENSMUSP00000039757
Gene: ENSMUSG00000035021
AA Change: Y1466*

DomainStartEndE-ValueType
Pfam:WAC_Acf1_DNA_bd 23 122 4.4e-36 PFAM
low complexity region 164 175 N/A INTRINSIC
coiled coil region 312 397 N/A INTRINSIC
Pfam:DDT 423 485 2.3e-14 PFAM
low complexity region 519 530 N/A INTRINSIC
Pfam:WHIM1 593 641 1.5e-8 PFAM
low complexity region 658 696 N/A INTRINSIC
low complexity region 725 738 N/A INTRINSIC
low complexity region 774 796 N/A INTRINSIC
low complexity region 861 873 N/A INTRINSIC
Pfam:WHIM3 894 932 2e-16 PFAM
low complexity region 1058 1073 N/A INTRINSIC
PHD 1151 1197 9.46e-15 SMART
RING 1152 1196 6.88e-1 SMART
low complexity region 1214 1257 N/A INTRINSIC
BROMO 1426 1534 2.18e-31 SMART
Predicted Effect probably null
Transcript: ENSMUST00000173433
AA Change: Y1463*
SMART Domains Protein: ENSMUSP00000133478
Gene: ENSMUSG00000035021
AA Change: Y1463*

DomainStartEndE-ValueType
Pfam:WAC_Acf1_DNA_bd 22 122 1.1e-37 PFAM
low complexity region 164 175 N/A INTRINSIC
coiled coil region 312 397 N/A INTRINSIC
DDT 422 487 1.54e-19 SMART
low complexity region 518 529 N/A INTRINSIC
Pfam:WHIM1 592 640 1.8e-8 PFAM
low complexity region 657 695 N/A INTRINSIC
low complexity region 722 735 N/A INTRINSIC
low complexity region 771 793 N/A INTRINSIC
low complexity region 858 870 N/A INTRINSIC
low complexity region 1055 1070 N/A INTRINSIC
PHD 1148 1194 9.46e-15 SMART
RING 1149 1193 6.88e-1 SMART
low complexity region 1211 1254 N/A INTRINSIC
BROMO 1423 1531 2.18e-31 SMART
Meta Mutation Damage Score 0.9756 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (54/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The BAZ1A gene encodes the accessory subunit of the ATP-dependent chromatin assembly factor (ACF), a member of the ISWI ('imitation switch') family of chromatin remodeling complexes (summarized by Racki et al., 2009 [PubMed 20033039]).[supplied by OMIM, Apr 2010]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and able to repair meiotic double-strand breaks but exhibit teratospermia, oligospermia, asthenospermia, and male infertility due to impaired spermiogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1b T A 5: 8,878,870 (GRCm39) N751K possibly damaging Het
Akap13 G A 7: 75,380,213 (GRCm39) R462H probably damaging Het
Ccng1 G A 11: 40,642,096 (GRCm39) H229Y probably benign Het
Cenpn C A 8: 117,663,976 (GRCm39) T256N probably benign Het
Ciart A G 3: 95,788,629 (GRCm39) V70A possibly damaging Het
Clcc1 A G 3: 108,568,774 (GRCm39) N36S probably damaging Het
Dmrt1 T A 19: 25,523,245 (GRCm39) S199T possibly damaging Het
Dmrt3 T C 19: 25,588,272 (GRCm39) V37A possibly damaging Het
Dock1 T A 7: 134,346,786 (GRCm39) D239E possibly damaging Het
Dyrk3 A G 1: 131,063,995 (GRCm39) probably null Het
Esyt1 T C 10: 128,347,354 (GRCm39) E1057G probably benign Het
Fsip2 A G 2: 82,818,793 (GRCm39) E4842G possibly damaging Het
Gadd45b G A 10: 80,766,984 (GRCm39) V90I probably benign Het
Gfi1 T A 5: 107,871,667 (GRCm39) H79L probably damaging Het
Golm2 T C 2: 121,737,242 (GRCm39) V261A probably benign Het
Idh2 T C 7: 79,748,001 (GRCm39) H233R probably benign Het
Itsn2 G A 12: 4,714,553 (GRCm39) A950T probably benign Het
Kcna5 A G 6: 126,510,517 (GRCm39) L537P probably benign Het
Krtap5-4 C T 7: 141,857,671 (GRCm39) Q114* probably null Het
Loxl3 T C 6: 83,027,790 (GRCm39) F734S possibly damaging Het
Lpcat1 C T 13: 73,659,498 (GRCm39) T420I probably damaging Het
Lrch3 A T 16: 32,826,083 (GRCm39) D720V possibly damaging Het
Lrrk1 T C 7: 65,915,222 (GRCm39) D1622G possibly damaging Het
Meioc G C 11: 102,567,569 (GRCm39) A788P probably damaging Het
Mmp1a A T 9: 7,467,236 (GRCm39) T271S possibly damaging Het
Nrp2 C T 1: 62,784,567 (GRCm39) R239C probably damaging Het
Ntrk3 T A 7: 78,103,076 (GRCm39) D408V probably benign Het
Odf1 A G 15: 38,226,840 (GRCm39) I247V unknown Het
Or14j5 A T 17: 38,161,693 (GRCm39) D70V probably damaging Het
Or8k39 A G 2: 86,563,848 (GRCm39) L36P probably damaging Het
Pcsk1 T C 13: 75,274,958 (GRCm39) S516P probably benign Het
Phactr3 A C 2: 177,974,737 (GRCm39) R523S probably damaging Het
Pikfyve A G 1: 65,294,293 (GRCm39) D1411G probably damaging Het
Ppcs A T 4: 119,276,262 (GRCm39) S281T probably benign Het
Prkcg A G 7: 3,362,708 (GRCm39) D294G probably benign Het
Psg28 T A 7: 18,156,922 (GRCm39) I438L probably damaging Het
Pspc1 G A 14: 57,009,304 (GRCm39) Q177* probably null Het
Rbm33 G A 5: 28,599,606 (GRCm39) G185R Het
Rps6ka5 T C 12: 100,544,048 (GRCm39) E350G probably damaging Het
Satb2 A G 1: 56,910,917 (GRCm39) S243P probably benign Het
Serinc5 T C 13: 92,797,699 (GRCm39) probably null Het
Sgce T C 6: 4,691,636 (GRCm39) D313G probably damaging Het
Sntg1 C T 1: 8,433,794 (GRCm39) V486I probably damaging Het
Stxbp5 A G 10: 9,692,046 (GRCm39) V366A probably damaging Het
Tep1 A G 14: 51,061,687 (GRCm39) S2610P possibly damaging Het
Tlr3 G A 8: 45,853,819 (GRCm39) T167M not run Het
Tmem200a A G 10: 25,869,904 (GRCm39) S122P probably damaging Het
Tmprss15 C T 16: 78,887,751 (GRCm39) V19M probably damaging Het
Tnks2 T A 19: 36,829,901 (GRCm39) M194K probably benign Het
Trav14d-3-dv8 A C 14: 53,316,224 (GRCm39) Q28P probably damaging Het
Trpm5 T C 7: 142,634,106 (GRCm39) E700G probably benign Het
Ubqln3 T A 7: 103,791,797 (GRCm39) I98L probably benign Het
Uso1 A T 5: 92,314,439 (GRCm39) E115D probably benign Het
Vmn1r28 T C 6: 58,242,178 (GRCm39) V7A probably benign Het
Other mutations in Baz1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01108:Baz1a APN 12 54,963,516 (GRCm39) missense probably benign
IGL01138:Baz1a APN 12 54,977,110 (GRCm39) missense probably damaging 1.00
IGL01298:Baz1a APN 12 55,001,594 (GRCm39) missense probably damaging 1.00
IGL02639:Baz1a APN 12 54,942,810 (GRCm39) splice site probably benign
IGL02995:Baz1a APN 12 54,947,232 (GRCm39) missense probably damaging 1.00
IGL03001:Baz1a APN 12 54,969,896 (GRCm39) missense possibly damaging 0.50
IGL03104:Baz1a APN 12 54,941,743 (GRCm39) missense probably damaging 1.00
IGL03135:Baz1a APN 12 54,976,375 (GRCm39) missense probably damaging 1.00
IGL03151:Baz1a APN 12 54,955,934 (GRCm39) critical splice acceptor site probably null
IGL03235:Baz1a APN 12 54,945,320 (GRCm39) missense probably damaging 1.00
IGL03240:Baz1a APN 12 54,974,352 (GRCm39) nonsense probably null
Bezos UTSW 12 54,941,816 (GRCm39) nonsense probably null
Flavia UTSW 12 55,022,093 (GRCm39) missense probably damaging 1.00
gumdrops UTSW 12 54,947,233 (GRCm39) missense probably damaging 1.00
Kilter UTSW 12 54,947,317 (GRCm39) missense probably damaging 0.99
Kisses UTSW 12 55,021,922 (GRCm39) missense probably damaging 1.00
liverlips UTSW 12 54,967,928 (GRCm39) missense possibly damaging 0.68
smooch UTSW 12 54,963,608 (GRCm39) missense probably damaging 1.00
Smootch UTSW 12 54,958,170 (GRCm39) missense probably damaging 1.00
PIT4458001:Baz1a UTSW 12 54,977,095 (GRCm39) missense probably benign 0.03
R0127:Baz1a UTSW 12 54,945,491 (GRCm39) missense possibly damaging 0.93
R0183:Baz1a UTSW 12 54,958,172 (GRCm39) missense probably damaging 1.00
R0393:Baz1a UTSW 12 54,965,221 (GRCm39) critical splice donor site probably null
R0532:Baz1a UTSW 12 54,981,605 (GRCm39) missense possibly damaging 0.55
R0614:Baz1a UTSW 12 54,988,304 (GRCm39) nonsense probably null
R0626:Baz1a UTSW 12 55,022,055 (GRCm39) missense probably damaging 0.99
R0654:Baz1a UTSW 12 54,958,182 (GRCm39) missense probably benign 0.01
R0782:Baz1a UTSW 12 54,941,273 (GRCm39) missense probably damaging 1.00
R0826:Baz1a UTSW 12 54,977,097 (GRCm39) nonsense probably null
R0855:Baz1a UTSW 12 54,947,348 (GRCm39) splice site probably benign
R0927:Baz1a UTSW 12 54,941,773 (GRCm39) missense probably damaging 1.00
R0941:Baz1a UTSW 12 54,945,216 (GRCm39) missense probably benign 0.00
R1079:Baz1a UTSW 12 54,941,785 (GRCm39) missense possibly damaging 0.91
R1157:Baz1a UTSW 12 54,976,349 (GRCm39) missense probably damaging 1.00
R1647:Baz1a UTSW 12 55,021,983 (GRCm39) missense probably damaging 1.00
R1731:Baz1a UTSW 12 54,965,330 (GRCm39) missense possibly damaging 0.83
R1739:Baz1a UTSW 12 54,945,573 (GRCm39) nonsense probably null
R1762:Baz1a UTSW 12 54,955,805 (GRCm39) missense probably damaging 1.00
R1770:Baz1a UTSW 12 54,945,293 (GRCm39) missense probably damaging 1.00
R1968:Baz1a UTSW 12 54,947,122 (GRCm39) missense possibly damaging 0.91
R2037:Baz1a UTSW 12 54,976,431 (GRCm39) missense probably damaging 1.00
R2111:Baz1a UTSW 12 54,958,170 (GRCm39) missense probably damaging 1.00
R2215:Baz1a UTSW 12 55,022,154 (GRCm39) nonsense probably null
R2282:Baz1a UTSW 12 54,963,597 (GRCm39) nonsense probably null
R2875:Baz1a UTSW 12 54,969,904 (GRCm39) missense probably damaging 1.00
R2890:Baz1a UTSW 12 54,945,302 (GRCm39) missense probably benign
R2971:Baz1a UTSW 12 54,970,224 (GRCm39) missense probably damaging 1.00
R3404:Baz1a UTSW 12 54,963,774 (GRCm39) missense probably benign 0.00
R3419:Baz1a UTSW 12 54,993,684 (GRCm39) missense probably benign 0.05
R3699:Baz1a UTSW 12 54,963,831 (GRCm39) missense probably benign 0.09
R3899:Baz1a UTSW 12 54,981,589 (GRCm39) missense probably benign 0.01
R3927:Baz1a UTSW 12 54,967,928 (GRCm39) missense possibly damaging 0.68
R4050:Baz1a UTSW 12 54,976,404 (GRCm39) missense probably benign 0.00
R4072:Baz1a UTSW 12 54,988,345 (GRCm39) missense probably benign 0.18
R4196:Baz1a UTSW 12 54,958,200 (GRCm39) missense probably damaging 1.00
R4289:Baz1a UTSW 12 54,947,233 (GRCm39) missense probably damaging 1.00
R4455:Baz1a UTSW 12 54,958,153 (GRCm39) missense probably benign 0.26
R4583:Baz1a UTSW 12 54,969,325 (GRCm39) missense probably damaging 0.99
R4622:Baz1a UTSW 12 54,988,300 (GRCm39) missense probably benign 0.00
R4807:Baz1a UTSW 12 54,945,267 (GRCm39) missense probably benign 0.28
R4998:Baz1a UTSW 12 55,021,922 (GRCm39) missense probably damaging 1.00
R5239:Baz1a UTSW 12 54,945,129 (GRCm39) missense probably damaging 0.99
R5379:Baz1a UTSW 12 54,941,133 (GRCm39) missense probably damaging 1.00
R5408:Baz1a UTSW 12 54,969,835 (GRCm39) missense probably damaging 1.00
R5678:Baz1a UTSW 12 54,947,317 (GRCm39) missense probably damaging 0.99
R5810:Baz1a UTSW 12 54,974,500 (GRCm39) intron probably benign
R6092:Baz1a UTSW 12 54,955,868 (GRCm39) missense possibly damaging 0.88
R6317:Baz1a UTSW 12 55,001,585 (GRCm39) missense possibly damaging 0.92
R6332:Baz1a UTSW 12 54,965,339 (GRCm39) missense probably benign 0.01
R6803:Baz1a UTSW 12 54,988,340 (GRCm39) missense probably null 0.99
R7185:Baz1a UTSW 12 55,022,093 (GRCm39) missense probably damaging 1.00
R7248:Baz1a UTSW 12 54,947,293 (GRCm39) missense probably damaging 1.00
R7392:Baz1a UTSW 12 54,945,550 (GRCm39) missense probably damaging 1.00
R8025:Baz1a UTSW 12 54,955,921 (GRCm39) missense probably benign 0.34
R8392:Baz1a UTSW 12 54,969,908 (GRCm39) missense probably damaging 1.00
R8862:Baz1a UTSW 12 55,032,624 (GRCm39) unclassified probably benign
R8949:Baz1a UTSW 12 54,941,238 (GRCm39) missense probably damaging 1.00
R9340:Baz1a UTSW 12 54,963,372 (GRCm39) missense probably damaging 0.97
R9389:Baz1a UTSW 12 54,963,608 (GRCm39) missense probably damaging 1.00
R9401:Baz1a UTSW 12 54,963,339 (GRCm39) missense probably damaging 1.00
R9666:Baz1a UTSW 12 54,988,345 (GRCm39) missense probably benign 0.18
R9722:Baz1a UTSW 12 54,946,882 (GRCm39) missense probably benign 0.43
R9746:Baz1a UTSW 12 55,021,895 (GRCm39) frame shift probably null
Predicted Primers PCR Primer
(F):5'- AATGAGCATTTGAGGAACCTCC -3'
(R):5'- ATTGCCCTGAATTCCAGCC -3'

Sequencing Primer
(F):5'- ACCTCCTGGGCTGCCAAAC -3'
(R):5'- ATTGCCCTGAATTCCAGCCTTTATC -3'
Posted On 2020-01-23