Incidental Mutation 'R8010:C130026I21Rik'
ID616832
Institutional Source Beutler Lab
Gene Symbol C130026I21Rik
Ensembl Gene ENSMUSG00000052477
Gene NameRIKEN cDNA C130026I21 gene
SynonymsOTTMUSG00000029174
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.313) question?
Stock #R8010 (G1)
Quality Score95.0077
Status Not validated
Chromosome1
Chromosomal Location84992690-85270566 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 85246950 bp
ZygosityHeterozygous
Amino Acid Change Serine to Leucine at position 288 (S288L)
Ref Sequence ENSEMBL: ENSMUSP00000091224 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064341] [ENSMUST00000093506] [ENSMUST00000159582] [ENSMUST00000161267] [ENSMUST00000162421]
Predicted Effect unknown
Transcript: ENSMUST00000064341
AA Change: S260L
SMART Domains Protein: ENSMUSP00000066587
Gene: ENSMUSG00000052477
AA Change: S260L

DomainStartEndE-ValueType
Pfam:Sp100 23 125 2.8e-38 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000093506
AA Change: S288L

PolyPhen 2 Score 0.533 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000091224
Gene: ENSMUSG00000052477
AA Change: S288L

DomainStartEndE-ValueType
Pfam:Sp100 24 122 1.1e-40 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159582
SMART Domains Protein: ENSMUSP00000125160
Gene: ENSMUSG00000052477

DomainStartEndE-ValueType
Pfam:Sp100 23 125 6.1e-39 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000161267
SMART Domains Protein: ENSMUSP00000124435
Gene: ENSMUSG00000052477

DomainStartEndE-ValueType
Pfam:Sp100 23 119 1.8e-37 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000161685
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162347
AA Change: D34N
Predicted Effect probably benign
Transcript: ENSMUST00000162421
SMART Domains Protein: ENSMUSP00000125215
Gene: ENSMUSG00000052477

DomainStartEndE-ValueType
Pfam:Sp100 40 135 2.2e-39 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 T A 6: 128,580,340 H130L probably benign Het
Abca1 A G 4: 53,127,600 S140P probably benign Het
AI314180 T A 4: 58,832,681 Q893L unknown Het
Aoc1 T C 6: 48,905,648 Y153H probably benign Het
Arhgdib A G 6: 136,926,722 I118T probably damaging Het
Atp1a3 T A 7: 24,980,645 E865V possibly damaging Het
Atrnl1 T C 19: 57,682,446 V587A probably benign Het
Ccdc107 G T 4: 43,495,768 E199* probably null Het
Cd55 A T 1: 130,459,616 D148E probably benign Het
Cdc42ep1 C T 15: 78,847,799 T148I possibly damaging Het
Cep164 A T 9: 45,823,671 D19E unknown Het
Chsy3 A G 18: 59,410,154 Y788C probably damaging Het
Cttnbp2 G C 6: 18,426,093 A762G possibly damaging Het
Cubn A G 2: 13,336,086 probably null Het
Ddr1 T A 17: 35,691,492 M175L possibly damaging Het
Dicer1 C A 12: 104,692,132 K1850N probably damaging Het
Dnajc6 C T 4: 101,618,414 R495C probably benign Het
Fbxo18 A T 2: 11,767,632 N79K probably benign Het
Frmpd1 T A 4: 45,284,272 V1031D possibly damaging Het
Gm7298 A G 6: 121,735,583 E118G probably benign Het
Hnrnpll T C 17: 80,061,956 T13A unknown Het
Jcad A G 18: 4,674,581 D781G probably benign Het
Kitl A T 10: 100,051,903 T25S probably benign Het
Krt5 T C 15: 101,712,356 D152G probably damaging Het
Krtap5-5 T C 7: 142,229,911 M1V probably null Het
Ktn1 C T 14: 47,705,773 T862I possibly damaging Het
Mapk4 A T 18: 73,930,576 I525N probably benign Het
Megf6 T C 4: 154,270,507 F1457S probably benign Het
Mrm3 A T 11: 76,250,347 S394C probably damaging Het
Mtmr4 T G 11: 87,598,864 V71G probably damaging Het
Nek8 T C 11: 78,176,596 Y4C probably damaging Het
Olfr203 T C 16: 59,303,504 M117T probably damaging Het
Olfr309 T A 7: 86,307,052 E20D probably benign Het
Olfr849 A T 9: 19,441,692 I260L probably benign Het
Pla2r1 T C 2: 60,514,960 T351A probably benign Het
Plcb4 C T 2: 135,907,560 T49M probably benign Het
Psg20 T C 7: 18,681,067 D301G probably benign Het
Ptpn13 C T 5: 103,559,937 Q1455* probably null Het
Rbbp8 A T 18: 11,722,233 N505I possibly damaging Het
Rgs18 A G 1: 144,756,000 C125R probably benign Het
Rpap2 G A 5: 107,603,605 C105Y probably damaging Het
Scn10a C T 9: 119,661,167 G570R possibly damaging Het
Sell C T 1: 164,065,512 T99I possibly damaging Het
Slc14a1 A T 18: 78,116,489 M63K probably benign Het
Syne2 A T 12: 75,930,738 D1319V probably benign Het
Tdp2 C T 13: 24,836,027 T99I probably damaging Het
Tet3 A T 6: 83,403,246 S647T unknown Het
Tpd52l1 T G 10: 31,358,013 D48A possibly damaging Het
Ttll10 T C 4: 156,047,161 D169G probably damaging Het
Wars2 C A 3: 99,216,830 L336I probably benign Het
Wdfy4 C A 14: 32,971,627 W2906L Het
Xdh A T 17: 73,909,317 Y711* probably null Het
Xirp1 T A 9: 120,017,824 R664S probably benign Het
Other mutations in C130026I21Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01866:C130026I21Rik APN 1 85254186 intron probably benign
IGL01876:C130026I21Rik APN 1 85254186 intron probably benign
IGL01880:C130026I21Rik APN 1 85254186 intron probably benign
IGL01883:C130026I21Rik APN 1 85254186 intron probably benign
IGL01886:C130026I21Rik APN 1 85254186 intron probably benign
IGL01888:C130026I21Rik APN 1 85254186 intron probably benign
IGL01893:C130026I21Rik APN 1 85254186 intron probably benign
IGL01898:C130026I21Rik APN 1 85254186 intron probably benign
IGL01906:C130026I21Rik APN 1 85254186 intron probably benign
IGL01908:C130026I21Rik APN 1 85254186 intron probably benign
IGL01909:C130026I21Rik APN 1 85254186 intron probably benign
IGL01916:C130026I21Rik APN 1 85254186 intron probably benign
IGL01918:C130026I21Rik APN 1 85254186 intron probably benign
IGL01920:C130026I21Rik APN 1 85254186 intron probably benign
IGL01923:C130026I21Rik APN 1 85254186 intron probably benign
IGL01928:C130026I21Rik APN 1 85254186 intron probably benign
IGL01933:C130026I21Rik APN 1 85254186 intron probably benign
IGL01945:C130026I21Rik APN 1 85254186 intron probably benign
IGL01949:C130026I21Rik APN 1 85254186 intron probably benign
IGL01951:C130026I21Rik APN 1 85254186 intron probably benign
IGL01952:C130026I21Rik APN 1 85254186 intron probably benign
PIT4131001:C130026I21Rik UTSW 1 85245674 intron probably benign
PIT4142001:C130026I21Rik UTSW 1 85245674 intron probably benign
R0067:C130026I21Rik UTSW 1 85270052 missense probably benign 0.00
R0367:C130026I21Rik UTSW 1 85270103 start gained probably benign
R0389:C130026I21Rik UTSW 1 85270052 missense probably benign 0.00
R1284:C130026I21Rik UTSW 1 85270055 missense probably damaging 0.98
R1620:C130026I21Rik UTSW 1 85254186 intron probably benign
R1622:C130026I21Rik UTSW 1 85254186 intron probably benign
R1671:C130026I21Rik UTSW 1 85257385 critical splice donor site probably null
R3115:C130026I21Rik UTSW 1 85257385 intron probably benign
R4120:C130026I21Rik UTSW 1 85259821 missense possibly damaging 0.82
R4223:C130026I21Rik UTSW 1 85112557 missense probably damaging 0.98
R4947:C130026I21Rik UTSW 1 85112482 missense probably damaging 1.00
R4996:C130026I21Rik UTSW 1 85247094 missense probably benign 0.12
R5152:C130026I21Rik UTSW 1 85261860 missense probably benign 0.04
R6614:C130026I21Rik UTSW 1 85202060 splice site probably null
R7675:C130026I21Rik UTSW 1 85247015 missense probably benign
R7784:C130026I21Rik UTSW 1 85212474 splice site probably null
R7839:C130026I21Rik UTSW 1 85247015 missense probably benign
R8034:C130026I21Rik UTSW 1 85254160 missense probably benign 0.35
Z1176:C130026I21Rik UTSW 1 85113523 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGACGTACACCTTGGGAAG -3'
(R):5'- GAGTTGTCTCAGCAGGAGTG -3'

Sequencing Primer
(F):5'- AGACGTACACCTTGGGAAGTTTTTAG -3'
(R):5'- CCCTCACCTGGACATGGAGTTC -3'
Posted On2020-01-23