Incidental Mutation 'R8010:Cd55'
ID616833
Institutional Source Beutler Lab
Gene Symbol Cd55
Ensembl Gene ENSMUSG00000026399
Gene NameCD55 molecule, decay accelerating factor for complement
Synonymscomplement-glycosylphosphatidylinositol, Daf1, Cromer blood group, GPI-DAF, Daf-GPI
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8010 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location130439027-130462744 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 130459616 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 148 (D148E)
Ref Sequence ENSEMBL: ENSMUSP00000027650 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027650]
Predicted Effect probably benign
Transcript: ENSMUST00000027650
AA Change: D148E

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000027650
Gene: ENSMUSG00000026399
AA Change: D148E

DomainStartEndE-ValueType
low complexity region 11 30 N/A INTRINSIC
CCP 36 94 2.21e-12 SMART
CCP 98 158 3.56e-7 SMART
CCP 163 220 6.34e-13 SMART
CCP 225 284 1.28e-17 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes an inhibitor of both the classical and the alternative pathways of complement activation. The encoded preproprotein undergoes post-translational processing to generate a mature polypeptide anchored to the plasma membrane via a glycosylphosphatidylinositol moiety. Erythrocytes from mice deficient in the encoded protein exhibit impaired regulation of complement activation resulting in enhanced complement deposition. Mice lacking the encoded protein exhibit enhanced susceptibility to experimentally induced myasthenia gravis. This gene is located adjacent to a closely related gene on chromosome 1. [provided by RefSeq, Nov 2015]
PHENOTYPE: Homozygous mutant mice show increased susceptibility to injury following ethanol exposure, to experimental autoimmune myasthenia gravis and to acute nephrotoxic nephritis. Another allele results in an abnormal complement cascade leading to increased C3 deposition. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 T A 6: 128,580,340 H130L probably benign Het
Abca1 A G 4: 53,127,600 S140P probably benign Het
AI314180 T A 4: 58,832,681 Q893L unknown Het
Aoc1 T C 6: 48,905,648 Y153H probably benign Het
Arhgdib A G 6: 136,926,722 I118T probably damaging Het
Atp1a3 T A 7: 24,980,645 E865V possibly damaging Het
Atrnl1 T C 19: 57,682,446 V587A probably benign Het
C130026I21Rik G A 1: 85,246,950 S288L possibly damaging Het
Ccdc107 G T 4: 43,495,768 E199* probably null Het
Cdc42ep1 C T 15: 78,847,799 T148I possibly damaging Het
Cep164 A T 9: 45,823,671 D19E unknown Het
Chsy3 A G 18: 59,410,154 Y788C probably damaging Het
Cttnbp2 G C 6: 18,426,093 A762G possibly damaging Het
Cubn A G 2: 13,336,086 probably null Het
Ddr1 T A 17: 35,691,492 M175L possibly damaging Het
Dicer1 C A 12: 104,692,132 K1850N probably damaging Het
Dnajc6 C T 4: 101,618,414 R495C probably benign Het
Fbxo18 A T 2: 11,767,632 N79K probably benign Het
Frmpd1 T A 4: 45,284,272 V1031D possibly damaging Het
Gm7298 A G 6: 121,735,583 E118G probably benign Het
Hnrnpll T C 17: 80,061,956 T13A unknown Het
Jcad A G 18: 4,674,581 D781G probably benign Het
Kitl A T 10: 100,051,903 T25S probably benign Het
Krt5 T C 15: 101,712,356 D152G probably damaging Het
Krtap5-5 T C 7: 142,229,911 M1V probably null Het
Ktn1 C T 14: 47,705,773 T862I possibly damaging Het
Mapk4 A T 18: 73,930,576 I525N probably benign Het
Megf6 T C 4: 154,270,507 F1457S probably benign Het
Mrm3 A T 11: 76,250,347 S394C probably damaging Het
Mtmr4 T G 11: 87,598,864 V71G probably damaging Het
Nek8 T C 11: 78,176,596 Y4C probably damaging Het
Olfr203 T C 16: 59,303,504 M117T probably damaging Het
Olfr309 T A 7: 86,307,052 E20D probably benign Het
Olfr849 A T 9: 19,441,692 I260L probably benign Het
Pla2r1 T C 2: 60,514,960 T351A probably benign Het
Plcb4 C T 2: 135,907,560 T49M probably benign Het
Psg20 T C 7: 18,681,067 D301G probably benign Het
Ptpn13 C T 5: 103,559,937 Q1455* probably null Het
Rbbp8 A T 18: 11,722,233 N505I possibly damaging Het
Rgs18 A G 1: 144,756,000 C125R probably benign Het
Rpap2 G A 5: 107,603,605 C105Y probably damaging Het
Scn10a C T 9: 119,661,167 G570R possibly damaging Het
Sell C T 1: 164,065,512 T99I possibly damaging Het
Slc14a1 A T 18: 78,116,489 M63K probably benign Het
Syne2 A T 12: 75,930,738 D1319V probably benign Het
Tdp2 C T 13: 24,836,027 T99I probably damaging Het
Tet3 A T 6: 83,403,246 S647T unknown Het
Tpd52l1 T G 10: 31,358,013 D48A possibly damaging Het
Ttll10 T C 4: 156,047,161 D169G probably damaging Het
Wars2 C A 3: 99,216,830 L336I probably benign Het
Wdfy4 C A 14: 32,971,627 W2906L Het
Xdh A T 17: 73,909,317 Y711* probably null Het
Xirp1 T A 9: 120,017,824 R664S probably benign Het
Other mutations in Cd55
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00809:Cd55 APN 1 130452511 nonsense probably null
IGL02207:Cd55 APN 1 130452419 missense possibly damaging 0.46
IGL02724:Cd55 APN 1 130449412 splice site probably benign
IGL02933:Cd55 APN 1 130452524 missense probably damaging 1.00
IGL02955:Cd55 APN 1 130449482 missense probably damaging 0.98
IGL03198:Cd55 APN 1 130440371 missense probably benign 0.03
PIT4618001:Cd55 UTSW 1 130456869 missense probably benign
R0055:Cd55 UTSW 1 130459576 splice site probably benign
R0411:Cd55 UTSW 1 130462557 splice site probably benign
R0426:Cd55 UTSW 1 130448372 missense probably benign 0.07
R1488:Cd55 UTSW 1 130448378 missense probably damaging 0.98
R1728:Cd55 UTSW 1 130449423 missense probably benign 0.32
R1728:Cd55 UTSW 1 130459633 missense probably benign
R1729:Cd55 UTSW 1 130449423 missense probably benign 0.32
R1729:Cd55 UTSW 1 130459633 missense probably benign
R1730:Cd55 UTSW 1 130449423 missense probably benign 0.32
R1730:Cd55 UTSW 1 130459633 missense probably benign
R1739:Cd55 UTSW 1 130449423 missense probably benign 0.32
R1739:Cd55 UTSW 1 130459633 missense probably benign
R1762:Cd55 UTSW 1 130449423 missense probably benign 0.32
R1762:Cd55 UTSW 1 130459633 missense probably benign
R1783:Cd55 UTSW 1 130449423 missense probably benign 0.32
R1783:Cd55 UTSW 1 130459633 missense probably benign
R1784:Cd55 UTSW 1 130449423 missense probably benign 0.32
R1784:Cd55 UTSW 1 130459633 missense probably benign
R1785:Cd55 UTSW 1 130449423 missense probably benign 0.32
R1785:Cd55 UTSW 1 130459633 missense probably benign
R1835:Cd55 UTSW 1 130447609 splice site probably benign
R2049:Cd55 UTSW 1 130449423 missense probably benign 0.32
R2122:Cd55 UTSW 1 130459617 missense possibly damaging 0.94
R2141:Cd55 UTSW 1 130449423 missense probably benign 0.32
R2142:Cd55 UTSW 1 130449423 missense probably benign 0.32
R2935:Cd55 UTSW 1 130452426 missense possibly damaging 0.65
R4326:Cd55 UTSW 1 130452483 missense probably damaging 1.00
R4328:Cd55 UTSW 1 130447367 intron probably benign
R4328:Cd55 UTSW 1 130452483 missense probably damaging 1.00
R4329:Cd55 UTSW 1 130452483 missense probably damaging 1.00
R5051:Cd55 UTSW 1 130448348 missense probably damaging 0.99
R6467:Cd55 UTSW 1 130447611 splice site probably benign
R7219:Cd55 UTSW 1 130462606 missense possibly damaging 0.73
Z1088:Cd55 UTSW 1 130452479 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GAGCTCTGTCAGTACGTATTCC -3'
(R):5'- AACGACTAGCTATTAGATTGCCTG -3'

Sequencing Primer
(F):5'- AGACATGGTATCTCCCCA -3'
(R):5'- TGCCTGGATTATAAACTAAGTTCAC -3'
Posted On2020-01-23