Incidental Mutation 'R8010:Rgs18'
ID616834
Institutional Source Beutler Lab
Gene Symbol Rgs18
Ensembl Gene ENSMUSG00000026357
Gene Nameregulator of G-protein signaling 18
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.087) question?
Stock #R8010 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location144752683-144775435 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 144756000 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 125 (C125R)
Ref Sequence ENSEMBL: ENSMUSP00000027603 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027603]
Predicted Effect probably benign
Transcript: ENSMUST00000027603
AA Change: C125R

PolyPhen 2 Score 0.296 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000027603
Gene: ENSMUSG00000026357
AA Change: C125R

DomainStartEndE-ValueType
RGS 86 202 5.42e-47 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the regulator of G-protein signaling family. This protein is contains a conserved, 120 amino acid motif called the RGS domain. The protein attenuates the signaling activity of G-proteins by binding to activated, GTP-bound G alpha subunits and acting as a GTPase activating protein (GAP), increasing the rate of conversion of the GTP to GDP. This hydrolysis allows the G alpha subunits to bind G beta/gamma subunit heterodimers, forming inactive G-protein heterotrimers, thereby terminating the signal. Alternate transcriptional splice variants of this gene have been observed but have not been thoroughly characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a null allele show reduced thermal nociception threshold, increased startle reflex, thrombocytopenia, defective megakaryopoiesis, and increased platelet aggregation. Homozygotes for a different null allele show decreased bleeding time, increased platelet aggregation, and thrombosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 T A 6: 128,580,340 H130L probably benign Het
Abca1 A G 4: 53,127,600 S140P probably benign Het
AI314180 T A 4: 58,832,681 Q893L unknown Het
Aoc1 T C 6: 48,905,648 Y153H probably benign Het
Arhgdib A G 6: 136,926,722 I118T probably damaging Het
Atp1a3 T A 7: 24,980,645 E865V possibly damaging Het
Atrnl1 T C 19: 57,682,446 V587A probably benign Het
C130026I21Rik G A 1: 85,246,950 S288L possibly damaging Het
Ccdc107 G T 4: 43,495,768 E199* probably null Het
Cd55 A T 1: 130,459,616 D148E probably benign Het
Cdc42ep1 C T 15: 78,847,799 T148I possibly damaging Het
Cep164 A T 9: 45,823,671 D19E unknown Het
Chsy3 A G 18: 59,410,154 Y788C probably damaging Het
Cttnbp2 G C 6: 18,426,093 A762G possibly damaging Het
Cubn A G 2: 13,336,086 probably null Het
Ddr1 T A 17: 35,691,492 M175L possibly damaging Het
Dicer1 C A 12: 104,692,132 K1850N probably damaging Het
Dnajc6 C T 4: 101,618,414 R495C probably benign Het
Fbxo18 A T 2: 11,767,632 N79K probably benign Het
Frmpd1 T A 4: 45,284,272 V1031D possibly damaging Het
Gm7298 A G 6: 121,735,583 E118G probably benign Het
Hnrnpll T C 17: 80,061,956 T13A unknown Het
Jcad A G 18: 4,674,581 D781G probably benign Het
Kitl A T 10: 100,051,903 T25S probably benign Het
Krt5 T C 15: 101,712,356 D152G probably damaging Het
Krtap5-5 T C 7: 142,229,911 M1V probably null Het
Ktn1 C T 14: 47,705,773 T862I possibly damaging Het
Mapk4 A T 18: 73,930,576 I525N probably benign Het
Megf6 T C 4: 154,270,507 F1457S probably benign Het
Mrm3 A T 11: 76,250,347 S394C probably damaging Het
Mtmr4 T G 11: 87,598,864 V71G probably damaging Het
Nek8 T C 11: 78,176,596 Y4C probably damaging Het
Olfr203 T C 16: 59,303,504 M117T probably damaging Het
Olfr309 T A 7: 86,307,052 E20D probably benign Het
Olfr849 A T 9: 19,441,692 I260L probably benign Het
Pla2r1 T C 2: 60,514,960 T351A probably benign Het
Plcb4 C T 2: 135,907,560 T49M probably benign Het
Psg20 T C 7: 18,681,067 D301G probably benign Het
Ptpn13 C T 5: 103,559,937 Q1455* probably null Het
Rbbp8 A T 18: 11,722,233 N505I possibly damaging Het
Rpap2 G A 5: 107,603,605 C105Y probably damaging Het
Scn10a C T 9: 119,661,167 G570R possibly damaging Het
Sell C T 1: 164,065,512 T99I possibly damaging Het
Slc14a1 A T 18: 78,116,489 M63K probably benign Het
Syne2 A T 12: 75,930,738 D1319V probably benign Het
Tdp2 C T 13: 24,836,027 T99I probably damaging Het
Tet3 A T 6: 83,403,246 S647T unknown Het
Tpd52l1 T G 10: 31,358,013 D48A possibly damaging Het
Ttll10 T C 4: 156,047,161 D169G probably damaging Het
Wars2 C A 3: 99,216,830 L336I probably benign Het
Wdfy4 C A 14: 32,971,627 W2906L Het
Xdh A T 17: 73,909,317 Y711* probably null Het
Xirp1 T A 9: 120,017,824 R664S probably benign Het
Other mutations in Rgs18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02471:Rgs18 APN 1 144774621 missense probably benign 0.12
R0603:Rgs18 UTSW 1 144756080 missense possibly damaging 0.92
R1635:Rgs18 UTSW 1 144754053 missense probably benign 0.34
R1923:Rgs18 UTSW 1 144756080 missense possibly damaging 0.77
R2115:Rgs18 UTSW 1 144753891 missense possibly damaging 0.77
R4560:Rgs18 UTSW 1 144755982 missense probably benign
R6409:Rgs18 UTSW 1 144775193 nonsense probably null
R7799:Rgs18 UTSW 1 144753865 missense probably damaging 1.00
X0065:Rgs18 UTSW 1 144773527 missense probably benign 0.36
Predicted Primers PCR Primer
(F):5'- AAAATCTTGAGCTCCCTGATGG -3'
(R):5'- GCCAACATATACTGTGTAAATGTGTGG -3'

Sequencing Primer
(F):5'- GGATGAGTGAGGAGTCCACTTTG -3'
(R):5'- GTGGATCCTTGTTGAATTAGAAAGAG -3'
Posted On2020-01-23