Incidental Mutation 'R8010:Sell'
ID616835
Institutional Source Beutler Lab
Gene Symbol Sell
Ensembl Gene ENSMUSG00000026581
Gene Nameselectin, lymphocyte
SynonymsLyam1, CD62L, L-selectin, Ly-m22, LECAM-1, Lyam-1, Ly-22, Lnhr
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8010 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location164061982-164084181 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 164065512 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 99 (T99I)
Ref Sequence ENSEMBL: ENSMUSP00000142237 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027871] [ENSMUST00000097491] [ENSMUST00000192047] [ENSMUST00000195358]
Predicted Effect possibly damaging
Transcript: ENSMUST00000027871
AA Change: T99I

PolyPhen 2 Score 0.952 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000027871
Gene: ENSMUSG00000026581
AA Change: T99I

DomainStartEndE-ValueType
CLECT 27 156 1.14e-19 SMART
EGF 159 192 6.55e-1 SMART
CCP 197 254 1.09e-11 SMART
CCP 259 316 1.09e-11 SMART
transmembrane domain 333 355 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000097491
AA Change: T99I

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000095099
Gene: ENSMUSG00000026581
AA Change: T99I

DomainStartEndE-ValueType
CLECT 27 156 1.14e-19 SMART
CCP 161 218 1.09e-11 SMART
CCP 223 280 1.09e-11 SMART
transmembrane domain 297 319 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000192047
AA Change: T99I

PolyPhen 2 Score 0.918 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000142237
Gene: ENSMUSG00000026581
AA Change: T99I

DomainStartEndE-ValueType
CLECT 27 156 1.14e-19 SMART
CCP 161 218 1.09e-11 SMART
CCP 223 280 1.09e-11 SMART
transmembrane domain 297 319 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000195358
SMART Domains Protein: ENSMUSP00000141365
Gene: ENSMUSG00000026581

DomainStartEndE-ValueType
Pfam:Sushi 1 31 1.3e-4 PFAM
transmembrane domain 48 70 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cell surface adhesion molecule that belongs to a family of adhesion/homing receptors. The encoded protein contains a C-type lectin-like domain, a calcium-binding epidermal growth factor-like domain, and two short complement-like repeats. The gene product is required for binding and subsequent rolling of leucocytes on endothelial cells, facilitating their migration into secondary lymphoid organs and inflammation sites. Single-nucleotide polymorphisms in this gene have been associated with various diseases including immunoglobulin A nephropathy. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygotes for targeted null mutations exhibit lack of lymphocyte binding to high endothelial venules of peripheral lymph nodes and defects in leukocyte rolling and neutrophil migration into the peritoneum following an inflammatory stimulus. Tumor cellsurvival is also reduced. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 T A 6: 128,580,340 H130L probably benign Het
Abca1 A G 4: 53,127,600 S140P probably benign Het
AI314180 T A 4: 58,832,681 Q893L unknown Het
Aoc1 T C 6: 48,905,648 Y153H probably benign Het
Arhgdib A G 6: 136,926,722 I118T probably damaging Het
Atp1a3 T A 7: 24,980,645 E865V possibly damaging Het
Atrnl1 T C 19: 57,682,446 V587A probably benign Het
C130026I21Rik G A 1: 85,246,950 S288L possibly damaging Het
Ccdc107 G T 4: 43,495,768 E199* probably null Het
Cd55 A T 1: 130,459,616 D148E probably benign Het
Cdc42ep1 C T 15: 78,847,799 T148I possibly damaging Het
Cep164 A T 9: 45,823,671 D19E unknown Het
Chsy3 A G 18: 59,410,154 Y788C probably damaging Het
Cttnbp2 G C 6: 18,426,093 A762G possibly damaging Het
Cubn A G 2: 13,336,086 probably null Het
Ddr1 T A 17: 35,691,492 M175L possibly damaging Het
Dicer1 C A 12: 104,692,132 K1850N probably damaging Het
Dnajc6 C T 4: 101,618,414 R495C probably benign Het
Fbxo18 A T 2: 11,767,632 N79K probably benign Het
Frmpd1 T A 4: 45,284,272 V1031D possibly damaging Het
Gm7298 A G 6: 121,735,583 E118G probably benign Het
Hnrnpll T C 17: 80,061,956 T13A unknown Het
Jcad A G 18: 4,674,581 D781G probably benign Het
Kitl A T 10: 100,051,903 T25S probably benign Het
Krt5 T C 15: 101,712,356 D152G probably damaging Het
Krtap5-5 T C 7: 142,229,911 M1V probably null Het
Ktn1 C T 14: 47,705,773 T862I possibly damaging Het
Mapk4 A T 18: 73,930,576 I525N probably benign Het
Megf6 T C 4: 154,270,507 F1457S probably benign Het
Mrm3 A T 11: 76,250,347 S394C probably damaging Het
Mtmr4 T G 11: 87,598,864 V71G probably damaging Het
Nek8 T C 11: 78,176,596 Y4C probably damaging Het
Olfr203 T C 16: 59,303,504 M117T probably damaging Het
Olfr309 T A 7: 86,307,052 E20D probably benign Het
Olfr849 A T 9: 19,441,692 I260L probably benign Het
Pla2r1 T C 2: 60,514,960 T351A probably benign Het
Plcb4 C T 2: 135,907,560 T49M probably benign Het
Psg20 T C 7: 18,681,067 D301G probably benign Het
Ptpn13 C T 5: 103,559,937 Q1455* probably null Het
Rbbp8 A T 18: 11,722,233 N505I possibly damaging Het
Rgs18 A G 1: 144,756,000 C125R probably benign Het
Rpap2 G A 5: 107,603,605 C105Y probably damaging Het
Scn10a C T 9: 119,661,167 G570R possibly damaging Het
Slc14a1 A T 18: 78,116,489 M63K probably benign Het
Syne2 A T 12: 75,930,738 D1319V probably benign Het
Tdp2 C T 13: 24,836,027 T99I probably damaging Het
Tet3 A T 6: 83,403,246 S647T unknown Het
Tpd52l1 T G 10: 31,358,013 D48A possibly damaging Het
Ttll10 T C 4: 156,047,161 D169G probably damaging Het
Wars2 C A 3: 99,216,830 L336I probably benign Het
Wdfy4 C A 14: 32,971,627 W2906L Het
Xdh A T 17: 73,909,317 Y711* probably null Het
Xirp1 T A 9: 120,017,824 R664S probably benign Het
Other mutations in Sell
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01981:Sell APN 1 164065626 missense probably benign 0.04
IGL02466:Sell APN 1 164069063 splice site probably null
IGL02578:Sell APN 1 164065596 missense probably damaging 1.00
IGL03243:Sell APN 1 164065342 missense possibly damaging 0.94
dim_sum UTSW 1 164066201 splice site probably null
dim_sum2 UTSW 1 164065661 nonsense probably null
R0125:Sell UTSW 1 164072105 splice site probably benign
R0800:Sell UTSW 1 164066201 splice site probably null
R1900:Sell UTSW 1 164065338 missense probably damaging 1.00
R3848:Sell UTSW 1 164065661 nonsense probably null
R4553:Sell UTSW 1 164072116 missense probably benign 0.08
R4671:Sell UTSW 1 164065473 missense probably damaging 1.00
R4685:Sell UTSW 1 164066260 missense probably damaging 1.00
R4896:Sell UTSW 1 164063062 missense probably benign 0.02
R4970:Sell UTSW 1 164065318 missense possibly damaging 0.75
R5112:Sell UTSW 1 164065318 missense possibly damaging 0.75
R6549:Sell UTSW 1 164065629 missense probably damaging 1.00
R7148:Sell UTSW 1 164065607 missense possibly damaging 0.85
R7545:Sell UTSW 1 164065334 missense probably benign 0.21
Predicted Primers PCR Primer
(F):5'- TGGAACTCACTGTTGGACTTACC -3'
(R):5'- ATCAGCGTAGGAGCCTAGACAC -3'

Sequencing Primer
(F):5'- GGACTTACCATTATTCTGAAAAGCCC -3'
(R):5'- ACTGCCTACCTGTGTAGCAG -3'
Posted On2020-01-23