Incidental Mutation 'R8010:Cubn'
ID 616837
Institutional Source Beutler Lab
Gene Symbol Cubn
Ensembl Gene ENSMUSG00000026726
Gene Name cubilin (intrinsic factor-cobalamin receptor)
Synonyms D2Wsu88e
MMRRC Submission 046050-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R8010 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 13276338-13491813 bp(-) (GRCm38)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 13336086 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000089009 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091436]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000091436
SMART Domains Protein: ENSMUSP00000089009
Gene: ENSMUSG00000026726

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
EGF 132 165 2.14e-5 SMART
EGF_CA 167 208 1.95e-8 SMART
EGF 213 258 2.85e-1 SMART
EGF_CA 260 301 2.66e-10 SMART
EGF_CA 302 345 7.07e-6 SMART
EGF 349 393 1.01e-1 SMART
EGF 398 430 3.73e-5 SMART
EGF_CA 432 468 8.63e-10 SMART
CUB 474 586 4.4e-21 SMART
CUB 590 702 3.82e-39 SMART
CUB 708 816 3.66e-18 SMART
CUB 817 928 3.09e-25 SMART
CUB 932 1042 1.29e-36 SMART
CUB 1048 1161 3.46e-37 SMART
CUB 1165 1277 7.24e-40 SMART
CUB 1278 1389 8.33e-31 SMART
CUB 1391 1506 3.08e-43 SMART
CUB 1510 1619 1.9e-34 SMART
CUB 1620 1734 7.24e-40 SMART
CUB 1738 1850 6.02e-37 SMART
CUB 1852 1963 1.57e-26 SMART
CUB 1978 2091 3.46e-28 SMART
CUB 2092 2213 2.88e-34 SMART
CUB 2217 2334 4.13e-35 SMART
CUB 2336 2448 3.1e-39 SMART
CUB 2452 2565 5.37e-34 SMART
CUB 2570 2687 3e-23 SMART
CUB 2689 2801 3.1e-39 SMART
CUB 2805 2919 2.36e-21 SMART
CUB 2920 3035 6.18e-25 SMART
CUB 3037 3150 5.16e-36 SMART
CUB 3157 3274 1.68e-35 SMART
CUB 3278 3393 7.17e-12 SMART
CUB 3395 3507 2.49e-29 SMART
CUB 3511 3623 2.4e-22 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Cubilin (CUBN) acts as a receptor for intrinsic factor-vitamin B12 complexes. The role of receptor is supported by the presence of 27 CUB domains. Cubulin is located within the epithelium of intestine and kidney. Mutations in CUBN may play a role in autosomal recessive megaloblastic anemia. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation display embryonic lethality during organogenesis, yolk sac and allantoic vasculature defects, embryonic and visceral endoderm defects, and lack somites. Heterozygotes display incomplete penetrance of premature death. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted, other(1) Gene trapped(3)

Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 T A 6: 128,580,340 (GRCm38) H130L probably benign Het
Abca1 A G 4: 53,127,600 (GRCm38) S140P probably benign Het
Aoc1 T C 6: 48,905,648 (GRCm38) Y153H probably benign Het
Arhgdib A G 6: 136,926,722 (GRCm38) I118T probably damaging Het
Atp1a3 T A 7: 24,980,645 (GRCm38) E865V possibly damaging Het
Atrnl1 T C 19: 57,682,446 (GRCm38) V587A probably benign Het
Ccdc107 G T 4: 43,495,768 (GRCm38) E199* probably null Het
Cd55 A T 1: 130,459,616 (GRCm38) D148E probably benign Het
Cdc42ep1 C T 15: 78,847,799 (GRCm38) T148I possibly damaging Het
Cep164 A T 9: 45,823,671 (GRCm38) D19E unknown Het
Chsy3 A G 18: 59,410,154 (GRCm38) Y788C probably damaging Het
Cttnbp2 G C 6: 18,426,093 (GRCm38) A762G possibly damaging Het
Ddr1 T A 17: 35,691,492 (GRCm38) M175L possibly damaging Het
Dicer1 C A 12: 104,692,132 (GRCm38) K1850N probably damaging Het
Dnajc6 C T 4: 101,618,414 (GRCm38) R495C probably benign Het
Ecpas T A 4: 58,832,681 (GRCm38) Q893L unknown Het
Fbh1 A T 2: 11,767,632 (GRCm38) N79K probably benign Het
Frmpd1 T A 4: 45,284,272 (GRCm38) V1031D possibly damaging Het
Gm7298 A G 6: 121,735,583 (GRCm38) E118G probably benign Het
Hnrnpll T C 17: 80,061,956 (GRCm38) T13A unknown Het
Jcad A G 18: 4,674,581 (GRCm38) D781G probably benign Het
Kitl A T 10: 100,051,903 (GRCm38) T25S probably benign Het
Krt5 T C 15: 101,712,356 (GRCm38) D152G probably damaging Het
Krtap5-5 T C 7: 142,229,911 (GRCm38) M1V probably null Het
Ktn1 C T 14: 47,705,773 (GRCm38) T862I possibly damaging Het
Mapk4 A T 18: 73,930,576 (GRCm38) I525N probably benign Het
Megf6 T C 4: 154,270,507 (GRCm38) F1457S probably benign Het
Mrm3 A T 11: 76,250,347 (GRCm38) S394C probably damaging Het
Mtmr4 T G 11: 87,598,864 (GRCm38) V71G probably damaging Het
Nek8 T C 11: 78,176,596 (GRCm38) Y4C probably damaging Het
Or13g1 T A 7: 86,307,052 (GRCm38) E20D probably benign Het
Or5ac21 T C 16: 59,303,504 (GRCm38) M117T probably damaging Het
Or7g30 A T 9: 19,441,692 (GRCm38) I260L probably benign Het
Pla2r1 T C 2: 60,514,960 (GRCm38) T351A probably benign Het
Plcb4 C T 2: 135,907,560 (GRCm38) T49M probably benign Het
Psg20 T C 7: 18,681,067 (GRCm38) D301G probably benign Het
Ptpn13 C T 5: 103,559,937 (GRCm38) Q1455* probably null Het
Rbbp8 A T 18: 11,722,233 (GRCm38) N505I possibly damaging Het
Rgs18 A G 1: 144,756,000 (GRCm38) C125R probably benign Het
Rpap2 G A 5: 107,603,605 (GRCm38) C105Y probably damaging Het
Scn10a C T 9: 119,661,167 (GRCm38) G570R possibly damaging Het
Sell C T 1: 164,065,512 (GRCm38) T99I possibly damaging Het
Slc14a1 A T 18: 78,116,489 (GRCm38) M63K probably benign Het
Sp140l2 G A 1: 85,246,950 (GRCm38) S288L possibly damaging Het
Syne2 A T 12: 75,930,738 (GRCm38) D1319V probably benign Het
Tdp2 C T 13: 24,836,027 (GRCm38) T99I probably damaging Het
Tet3 A T 6: 83,403,246 (GRCm38) S647T unknown Het
Tpd52l1 T G 10: 31,358,013 (GRCm38) D48A possibly damaging Het
Ttll10 T C 4: 156,047,161 (GRCm38) D169G probably damaging Het
Wars2 C A 3: 99,216,830 (GRCm38) L336I probably benign Het
Wdfy4 C A 14: 32,971,627 (GRCm38) W2906L Het
Xdh A T 17: 73,909,317 (GRCm38) Y711* probably null Het
Xirp1 T A 9: 120,017,824 (GRCm38) R664S probably benign Het
Other mutations in Cubn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Cubn APN 2 13,491,820 (GRCm38) unclassified probably benign
IGL00228:Cubn APN 2 13,456,697 (GRCm38) missense probably damaging 1.00
IGL00231:Cubn APN 2 13,381,849 (GRCm38) missense possibly damaging 0.89
IGL00327:Cubn APN 2 13,427,056 (GRCm38) missense possibly damaging 0.73
IGL00470:Cubn APN 2 13,278,418 (GRCm38) missense probably benign 0.00
IGL00519:Cubn APN 2 13,282,919 (GRCm38) missense probably benign 0.00
IGL00562:Cubn APN 2 13,294,230 (GRCm38) missense probably benign 0.01
IGL00678:Cubn APN 2 13,467,710 (GRCm38) missense possibly damaging 0.47
IGL00834:Cubn APN 2 13,381,927 (GRCm38) missense probably damaging 1.00
IGL00946:Cubn APN 2 13,456,623 (GRCm38) missense probably damaging 0.98
IGL00971:Cubn APN 2 13,278,408 (GRCm38) missense possibly damaging 0.77
IGL01124:Cubn APN 2 13,478,093 (GRCm38) missense possibly damaging 0.62
IGL01287:Cubn APN 2 13,310,566 (GRCm38) missense probably damaging 1.00
IGL01410:Cubn APN 2 13,465,908 (GRCm38) missense probably benign 0.31
IGL01418:Cubn APN 2 13,284,041 (GRCm38) missense probably benign 0.01
IGL01450:Cubn APN 2 13,350,862 (GRCm38) splice site probably benign
IGL01534:Cubn APN 2 13,465,933 (GRCm38) nonsense probably null
IGL01584:Cubn APN 2 13,308,661 (GRCm38) splice site probably benign
IGL01595:Cubn APN 2 13,325,216 (GRCm38) missense probably benign 0.05
IGL01625:Cubn APN 2 13,306,274 (GRCm38) missense possibly damaging 0.76
IGL01732:Cubn APN 2 13,489,936 (GRCm38) nonsense probably null
IGL01972:Cubn APN 2 13,446,072 (GRCm38) missense possibly damaging 0.90
IGL02027:Cubn APN 2 13,287,594 (GRCm38) missense probably damaging 1.00
IGL02033:Cubn APN 2 13,339,846 (GRCm38) missense probably damaging 0.98
IGL02124:Cubn APN 2 13,381,837 (GRCm38) missense probably damaging 0.99
IGL02335:Cubn APN 2 13,427,834 (GRCm38) splice site probably null
IGL02491:Cubn APN 2 13,321,228 (GRCm38) missense probably damaging 1.00
IGL02686:Cubn APN 2 13,325,226 (GRCm38) missense possibly damaging 0.92
IGL02707:Cubn APN 2 13,446,032 (GRCm38) missense probably damaging 0.99
IGL02746:Cubn APN 2 13,445,040 (GRCm38) missense probably damaging 1.00
IGL02873:Cubn APN 2 13,294,370 (GRCm38) missense probably benign 0.07
IGL02897:Cubn APN 2 13,318,312 (GRCm38) missense possibly damaging 0.55
IGL03078:Cubn APN 2 13,287,094 (GRCm38) missense possibly damaging 0.87
IGL03245:Cubn APN 2 13,355,689 (GRCm38) missense probably benign 0.09
IGL03289:Cubn APN 2 13,426,967 (GRCm38) missense probably benign 0.00
IGL03335:Cubn APN 2 13,360,329 (GRCm38) missense probably damaging 1.00
IGL03355:Cubn APN 2 13,478,057 (GRCm38) splice site probably null
mellow UTSW 2 13,478,078 (GRCm38) missense probably damaging 1.00
PIT4354001:Cubn UTSW 2 13,468,852 (GRCm38) nonsense probably null
PIT4495001:Cubn UTSW 2 13,491,750 (GRCm38) missense probably benign 0.00
R0145:Cubn UTSW 2 13,306,432 (GRCm38) missense probably damaging 1.00
R0220:Cubn UTSW 2 13,356,709 (GRCm38) missense probably damaging 1.00
R0254:Cubn UTSW 2 13,476,035 (GRCm38) critical splice donor site probably null
R0254:Cubn UTSW 2 13,440,514 (GRCm38) missense possibly damaging 0.84
R0254:Cubn UTSW 2 13,424,694 (GRCm38) missense probably benign 0.01
R0360:Cubn UTSW 2 13,310,507 (GRCm38) splice site probably benign
R0364:Cubn UTSW 2 13,310,507 (GRCm38) splice site probably benign
R0383:Cubn UTSW 2 13,430,959 (GRCm38) missense probably damaging 1.00
R0419:Cubn UTSW 2 13,469,764 (GRCm38) missense possibly damaging 0.87
R0419:Cubn UTSW 2 13,469,763 (GRCm38) missense possibly damaging 0.77
R0498:Cubn UTSW 2 13,444,267 (GRCm38) missense probably damaging 0.99
R0560:Cubn UTSW 2 13,428,680 (GRCm38) missense probably damaging 1.00
R0615:Cubn UTSW 2 13,360,252 (GRCm38) splice site probably null
R0735:Cubn UTSW 2 13,491,689 (GRCm38) splice site probably benign
R0780:Cubn UTSW 2 13,456,613 (GRCm38) missense probably damaging 1.00
R0899:Cubn UTSW 2 13,362,328 (GRCm38) missense possibly damaging 0.54
R1118:Cubn UTSW 2 13,336,242 (GRCm38) missense possibly damaging 0.78
R1182:Cubn UTSW 2 13,445,000 (GRCm38) missense probably damaging 0.98
R1439:Cubn UTSW 2 13,287,568 (GRCm38) missense probably damaging 0.96
R1450:Cubn UTSW 2 13,360,319 (GRCm38) missense probably damaging 1.00
R1464:Cubn UTSW 2 13,325,288 (GRCm38) missense possibly damaging 0.87
R1464:Cubn UTSW 2 13,325,288 (GRCm38) missense possibly damaging 0.87
R1476:Cubn UTSW 2 13,476,120 (GRCm38) missense probably benign 0.04
R1508:Cubn UTSW 2 13,427,105 (GRCm38) missense probably benign 0.25
R1532:Cubn UTSW 2 13,287,661 (GRCm38) missense probably damaging 1.00
R1562:Cubn UTSW 2 13,427,967 (GRCm38) missense probably damaging 1.00
R1598:Cubn UTSW 2 13,469,789 (GRCm38) missense probably benign 0.00
R1761:Cubn UTSW 2 13,489,317 (GRCm38) critical splice donor site probably null
R1862:Cubn UTSW 2 13,308,561 (GRCm38) missense probably damaging 1.00
R1874:Cubn UTSW 2 13,323,002 (GRCm38) missense probably damaging 1.00
R1923:Cubn UTSW 2 13,310,526 (GRCm38) missense probably damaging 1.00
R1944:Cubn UTSW 2 13,278,538 (GRCm38) missense probably benign 0.01
R1960:Cubn UTSW 2 13,340,017 (GRCm38) splice site probably null
R2021:Cubn UTSW 2 13,308,549 (GRCm38) missense probably benign 0.09
R2137:Cubn UTSW 2 13,336,167 (GRCm38) missense probably benign 0.01
R2138:Cubn UTSW 2 13,444,378 (GRCm38) missense probably damaging 0.99
R2139:Cubn UTSW 2 13,336,167 (GRCm38) missense probably benign 0.01
R2179:Cubn UTSW 2 13,318,242 (GRCm38) missense possibly damaging 0.85
R2328:Cubn UTSW 2 13,404,080 (GRCm38) nonsense probably null
R2369:Cubn UTSW 2 13,491,217 (GRCm38) missense probably damaging 1.00
R2428:Cubn UTSW 2 13,476,150 (GRCm38) missense probably damaging 1.00
R2435:Cubn UTSW 2 13,318,272 (GRCm38) missense probably damaging 1.00
R2567:Cubn UTSW 2 13,278,356 (GRCm38) splice site probably null
R2850:Cubn UTSW 2 13,322,953 (GRCm38) missense probably damaging 1.00
R2853:Cubn UTSW 2 13,430,834 (GRCm38) missense probably benign 0.00
R2893:Cubn UTSW 2 13,358,139 (GRCm38) missense possibly damaging 0.61
R3107:Cubn UTSW 2 13,362,347 (GRCm38) missense possibly damaging 0.73
R3109:Cubn UTSW 2 13,362,347 (GRCm38) missense possibly damaging 0.73
R3119:Cubn UTSW 2 13,358,162 (GRCm38) missense possibly damaging 0.90
R3405:Cubn UTSW 2 13,333,508 (GRCm38) missense probably benign 0.00
R3703:Cubn UTSW 2 13,350,943 (GRCm38) missense probably damaging 1.00
R3704:Cubn UTSW 2 13,350,943 (GRCm38) missense probably damaging 1.00
R3705:Cubn UTSW 2 13,350,943 (GRCm38) missense probably damaging 1.00
R3764:Cubn UTSW 2 13,331,585 (GRCm38) missense possibly damaging 0.79
R3792:Cubn UTSW 2 13,427,914 (GRCm38) missense probably damaging 1.00
R3802:Cubn UTSW 2 13,360,353 (GRCm38) missense probably benign 0.01
R3813:Cubn UTSW 2 13,294,325 (GRCm38) missense probably damaging 1.00
R3845:Cubn UTSW 2 13,283,008 (GRCm38) missense probably damaging 1.00
R3846:Cubn UTSW 2 13,283,008 (GRCm38) missense probably damaging 1.00
R3900:Cubn UTSW 2 13,286,980 (GRCm38) critical splice donor site probably null
R3921:Cubn UTSW 2 13,326,677 (GRCm38) missense probably damaging 1.00
R4075:Cubn UTSW 2 13,313,999 (GRCm38) missense possibly damaging 0.58
R4082:Cubn UTSW 2 13,428,563 (GRCm38) intron probably benign
R4405:Cubn UTSW 2 13,466,030 (GRCm38) missense probably damaging 1.00
R4615:Cubn UTSW 2 13,428,749 (GRCm38) missense probably damaging 1.00
R4629:Cubn UTSW 2 13,313,979 (GRCm38) splice site probably null
R4770:Cubn UTSW 2 13,314,767 (GRCm38) missense possibly damaging 0.92
R4799:Cubn UTSW 2 13,351,058 (GRCm38) missense probably damaging 1.00
R4799:Cubn UTSW 2 13,287,024 (GRCm38) missense possibly damaging 0.94
R4812:Cubn UTSW 2 13,459,076 (GRCm38) missense probably damaging 1.00
R4825:Cubn UTSW 2 13,325,225 (GRCm38) missense probably damaging 1.00
R4934:Cubn UTSW 2 13,489,910 (GRCm38) missense probably benign 0.06
R4967:Cubn UTSW 2 13,348,045 (GRCm38) missense probably benign 0.01
R5187:Cubn UTSW 2 13,287,568 (GRCm38) missense probably damaging 0.96
R5232:Cubn UTSW 2 13,478,202 (GRCm38) nonsense probably null
R5305:Cubn UTSW 2 13,388,939 (GRCm38) missense probably damaging 1.00
R5506:Cubn UTSW 2 13,491,695 (GRCm38) splice site probably null
R5530:Cubn UTSW 2 13,308,523 (GRCm38) missense probably damaging 1.00
R5531:Cubn UTSW 2 13,350,932 (GRCm38) missense probably benign 0.00
R5737:Cubn UTSW 2 13,388,891 (GRCm38) missense probably damaging 1.00
R5886:Cubn UTSW 2 13,320,023 (GRCm38) splice site probably benign
R5923:Cubn UTSW 2 13,486,078 (GRCm38) missense possibly damaging 0.73
R6032:Cubn UTSW 2 13,325,184 (GRCm38) missense probably benign 0.12
R6032:Cubn UTSW 2 13,325,184 (GRCm38) missense probably benign 0.12
R6084:Cubn UTSW 2 13,430,897 (GRCm38) missense probably damaging 1.00
R6087:Cubn UTSW 2 13,427,847 (GRCm38) missense probably damaging 1.00
R6133:Cubn UTSW 2 13,308,618 (GRCm38) missense probably benign 0.29
R6181:Cubn UTSW 2 13,349,876 (GRCm38) missense probably benign 0.31
R6301:Cubn UTSW 2 13,478,078 (GRCm38) missense probably damaging 1.00
R6320:Cubn UTSW 2 13,280,195 (GRCm38) missense probably damaging 1.00
R6368:Cubn UTSW 2 13,476,123 (GRCm38) missense probably damaging 0.98
R6368:Cubn UTSW 2 13,430,995 (GRCm38) missense probably damaging 0.96
R6383:Cubn UTSW 2 13,427,835 (GRCm38) critical splice donor site probably null
R6393:Cubn UTSW 2 13,355,680 (GRCm38) missense probably benign 0.08
R6408:Cubn UTSW 2 13,294,203 (GRCm38) missense probably damaging 1.00
R6470:Cubn UTSW 2 13,322,993 (GRCm38) missense possibly damaging 0.87
R6532:Cubn UTSW 2 13,459,002 (GRCm38) missense probably benign 0.01
R6599:Cubn UTSW 2 13,310,673 (GRCm38) missense possibly damaging 0.95
R6629:Cubn UTSW 2 13,430,872 (GRCm38) missense probably damaging 1.00
R6641:Cubn UTSW 2 13,476,064 (GRCm38) missense probably damaging 1.00
R6800:Cubn UTSW 2 13,321,255 (GRCm38) missense probably damaging 1.00
R6823:Cubn UTSW 2 13,445,029 (GRCm38) missense probably benign 0.21
R6847:Cubn UTSW 2 13,444,253 (GRCm38) critical splice donor site probably null
R6885:Cubn UTSW 2 13,318,278 (GRCm38) missense probably damaging 1.00
R6962:Cubn UTSW 2 13,348,029 (GRCm38) missense probably benign 0.03
R6973:Cubn UTSW 2 13,381,837 (GRCm38) missense possibly damaging 0.61
R6975:Cubn UTSW 2 13,486,789 (GRCm38) missense probably damaging 0.99
R7076:Cubn UTSW 2 13,306,281 (GRCm38) missense probably benign 0.10
R7076:Cubn UTSW 2 13,306,280 (GRCm38) missense probably benign 0.00
R7086:Cubn UTSW 2 13,319,858 (GRCm38) missense probably damaging 0.98
R7162:Cubn UTSW 2 13,342,498 (GRCm38) missense probably damaging 0.96
R7203:Cubn UTSW 2 13,351,003 (GRCm38) missense probably benign 0.01
R7292:Cubn UTSW 2 13,424,739 (GRCm38) missense probably damaging 0.99
R7307:Cubn UTSW 2 13,340,332 (GRCm38) missense probably damaging 0.99
R7329:Cubn UTSW 2 13,468,771 (GRCm38) missense probably damaging 0.99
R7395:Cubn UTSW 2 13,287,064 (GRCm38) missense probably damaging 1.00
R7417:Cubn UTSW 2 13,426,967 (GRCm38) missense probably benign 0.00
R7429:Cubn UTSW 2 13,322,993 (GRCm38) missense possibly damaging 0.87
R7430:Cubn UTSW 2 13,322,993 (GRCm38) missense possibly damaging 0.87
R7443:Cubn UTSW 2 13,455,509 (GRCm38) missense probably damaging 1.00
R7699:Cubn UTSW 2 13,489,917 (GRCm38) missense possibly damaging 0.74
R7699:Cubn UTSW 2 13,348,178 (GRCm38) missense probably benign
R7700:Cubn UTSW 2 13,489,917 (GRCm38) missense possibly damaging 0.74
R7700:Cubn UTSW 2 13,348,178 (GRCm38) missense probably benign
R7751:Cubn UTSW 2 13,360,365 (GRCm38) missense probably damaging 1.00
R7755:Cubn UTSW 2 13,280,078 (GRCm38) missense probably benign 0.11
R7759:Cubn UTSW 2 13,348,150 (GRCm38) missense probably damaging 1.00
R7903:Cubn UTSW 2 13,468,869 (GRCm38) missense probably damaging 0.97
R7921:Cubn UTSW 2 13,424,727 (GRCm38) missense probably benign 0.22
R7988:Cubn UTSW 2 13,332,355 (GRCm38) missense probably benign 0.43
R8020:Cubn UTSW 2 13,479,178 (GRCm38) missense probably benign 0.01
R8120:Cubn UTSW 2 13,331,660 (GRCm38) missense probably damaging 1.00
R8133:Cubn UTSW 2 13,388,848 (GRCm38) missense probably damaging 1.00
R8185:Cubn UTSW 2 13,294,318 (GRCm38) missense probably benign 0.11
R8224:Cubn UTSW 2 13,349,877 (GRCm38) missense probably benign 0.16
R8289:Cubn UTSW 2 13,486,802 (GRCm38) missense probably benign 0.10
R8326:Cubn UTSW 2 13,306,463 (GRCm38) missense probably benign 0.01
R8331:Cubn UTSW 2 13,340,242 (GRCm38) missense probably damaging 1.00
R8338:Cubn UTSW 2 13,430,847 (GRCm38) missense probably benign 0.08
R8341:Cubn UTSW 2 13,428,724 (GRCm38) missense probably damaging 1.00
R8358:Cubn UTSW 2 13,325,160 (GRCm38) missense probably benign 0.17
R8427:Cubn UTSW 2 13,428,756 (GRCm38) missense probably benign 0.00
R8432:Cubn UTSW 2 13,381,799 (GRCm38) missense probably benign 0.00
R8441:Cubn UTSW 2 13,427,847 (GRCm38) missense probably damaging 1.00
R8442:Cubn UTSW 2 13,314,044 (GRCm38) missense probably damaging 1.00
R8520:Cubn UTSW 2 13,308,520 (GRCm38) critical splice donor site probably null
R8699:Cubn UTSW 2 13,383,959 (GRCm38) missense probably damaging 1.00
R8753:Cubn UTSW 2 13,308,566 (GRCm38) nonsense probably null
R8874:Cubn UTSW 2 13,360,346 (GRCm38) missense possibly damaging 0.63
R9056:Cubn UTSW 2 13,456,655 (GRCm38) missense probably damaging 1.00
R9079:Cubn UTSW 2 13,287,103 (GRCm38) missense probably benign 0.02
R9143:Cubn UTSW 2 13,332,465 (GRCm38) splice site probably benign
R9261:Cubn UTSW 2 13,278,451 (GRCm38) missense probably damaging 1.00
R9338:Cubn UTSW 2 13,381,892 (GRCm38) missense probably damaging 1.00
R9342:Cubn UTSW 2 13,458,956 (GRCm38) missense probably damaging 0.99
R9603:Cubn UTSW 2 13,287,699 (GRCm38) missense probably damaging 1.00
R9614:Cubn UTSW 2 13,478,134 (GRCm38) missense probably benign 0.00
R9615:Cubn UTSW 2 13,321,180 (GRCm38) missense possibly damaging 0.88
R9616:Cubn UTSW 2 13,314,718 (GRCm38) missense probably benign 0.04
R9774:Cubn UTSW 2 13,428,719 (GRCm38) missense probably benign
X0018:Cubn UTSW 2 13,458,986 (GRCm38) missense probably damaging 1.00
X0022:Cubn UTSW 2 13,476,076 (GRCm38) missense probably damaging 1.00
X0026:Cubn UTSW 2 13,342,581 (GRCm38) missense probably damaging 1.00
X0063:Cubn UTSW 2 13,322,962 (GRCm38) missense probably damaging 1.00
YA93:Cubn UTSW 2 13,383,992 (GRCm38) missense probably benign 0.21
Z1088:Cubn UTSW 2 13,294,229 (GRCm38) missense probably benign 0.43
Z1176:Cubn UTSW 2 13,381,825 (GRCm38) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCAACAGCTATCAGGCAAGG -3'
(R):5'- GCTATGTCCTCATTCACCAGAC -3'

Sequencing Primer
(F):5'- CAGCTATCAGGCAAGGCTTTG -3'
(R):5'- TCATTCACCAGACTGCAGATTG -3'
Posted On 2020-01-23