Incidental Mutation 'R8010:Frmpd1'
ID616842
Institutional Source Beutler Lab
Gene Symbol Frmpd1
Ensembl Gene ENSMUSG00000035615
Gene NameFERM and PDZ domain containing 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8010 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location45184875-45285936 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 45284272 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 1031 (V1031D)
Ref Sequence ENSEMBL: ENSMUSP00000047232 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044773] [ENSMUST00000107804]
Predicted Effect possibly damaging
Transcript: ENSMUST00000044773
AA Change: V1031D

PolyPhen 2 Score 0.507 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000047232
Gene: ENSMUSG00000035615
AA Change: V1031D

DomainStartEndE-ValueType
PDZ 67 135 5.72e-10 SMART
B41 177 401 4.85e-30 SMART
low complexity region 523 537 N/A INTRINSIC
low complexity region 578 597 N/A INTRINSIC
PDB:4G2V|B 901 938 2e-15 PDB
low complexity region 962 980 N/A INTRINSIC
low complexity region 1019 1030 N/A INTRINSIC
low complexity region 1115 1130 N/A INTRINSIC
Blast:B41 1264 1488 3e-44 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000107804
AA Change: V1031D

PolyPhen 2 Score 0.507 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000103434
Gene: ENSMUSG00000035615
AA Change: V1031D

DomainStartEndE-ValueType
PDZ 67 135 5.72e-10 SMART
B41 177 401 4.85e-30 SMART
low complexity region 523 537 N/A INTRINSIC
low complexity region 578 597 N/A INTRINSIC
PDB:4G2V|B 901 938 2e-15 PDB
low complexity region 962 980 N/A INTRINSIC
low complexity region 1019 1030 N/A INTRINSIC
low complexity region 1115 1130 N/A INTRINSIC
Blast:B41 1264 1488 3e-44 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 T A 6: 128,580,340 H130L probably benign Het
Abca1 A G 4: 53,127,600 S140P probably benign Het
AI314180 T A 4: 58,832,681 Q893L unknown Het
Aoc1 T C 6: 48,905,648 Y153H probably benign Het
Arhgdib A G 6: 136,926,722 I118T probably damaging Het
Atp1a3 T A 7: 24,980,645 E865V possibly damaging Het
Atrnl1 T C 19: 57,682,446 V587A probably benign Het
C130026I21Rik G A 1: 85,246,950 S288L possibly damaging Het
Ccdc107 G T 4: 43,495,768 E199* probably null Het
Cd55 A T 1: 130,459,616 D148E probably benign Het
Cdc42ep1 C T 15: 78,847,799 T148I possibly damaging Het
Cep164 A T 9: 45,823,671 D19E unknown Het
Chsy3 A G 18: 59,410,154 Y788C probably damaging Het
Cttnbp2 G C 6: 18,426,093 A762G possibly damaging Het
Cubn A G 2: 13,336,086 probably null Het
Ddr1 T A 17: 35,691,492 M175L possibly damaging Het
Dicer1 C A 12: 104,692,132 K1850N probably damaging Het
Dnajc6 C T 4: 101,618,414 R495C probably benign Het
Fbxo18 A T 2: 11,767,632 N79K probably benign Het
Gm7298 A G 6: 121,735,583 E118G probably benign Het
Hnrnpll T C 17: 80,061,956 T13A unknown Het
Jcad A G 18: 4,674,581 D781G probably benign Het
Kitl A T 10: 100,051,903 T25S probably benign Het
Krt5 T C 15: 101,712,356 D152G probably damaging Het
Krtap5-5 T C 7: 142,229,911 M1V probably null Het
Ktn1 C T 14: 47,705,773 T862I possibly damaging Het
Mapk4 A T 18: 73,930,576 I525N probably benign Het
Megf6 T C 4: 154,270,507 F1457S probably benign Het
Mrm3 A T 11: 76,250,347 S394C probably damaging Het
Mtmr4 T G 11: 87,598,864 V71G probably damaging Het
Nek8 T C 11: 78,176,596 Y4C probably damaging Het
Olfr203 T C 16: 59,303,504 M117T probably damaging Het
Olfr309 T A 7: 86,307,052 E20D probably benign Het
Olfr849 A T 9: 19,441,692 I260L probably benign Het
Pla2r1 T C 2: 60,514,960 T351A probably benign Het
Plcb4 C T 2: 135,907,560 T49M probably benign Het
Psg20 T C 7: 18,681,067 D301G probably benign Het
Ptpn13 C T 5: 103,559,937 Q1455* probably null Het
Rbbp8 A T 18: 11,722,233 N505I possibly damaging Het
Rgs18 A G 1: 144,756,000 C125R probably benign Het
Rpap2 G A 5: 107,603,605 C105Y probably damaging Het
Scn10a C T 9: 119,661,167 G570R possibly damaging Het
Sell C T 1: 164,065,512 T99I possibly damaging Het
Slc14a1 A T 18: 78,116,489 M63K probably benign Het
Syne2 A T 12: 75,930,738 D1319V probably benign Het
Tdp2 C T 13: 24,836,027 T99I probably damaging Het
Tet3 A T 6: 83,403,246 S647T unknown Het
Tpd52l1 T G 10: 31,358,013 D48A possibly damaging Het
Ttll10 T C 4: 156,047,161 D169G probably damaging Het
Wars2 C A 3: 99,216,830 L336I probably benign Het
Wdfy4 C A 14: 32,971,627 W2906L Het
Xdh A T 17: 73,909,317 Y711* probably null Het
Xirp1 T A 9: 120,017,824 R664S probably benign Het
Other mutations in Frmpd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Frmpd1 APN 4 45279456 missense possibly damaging 0.61
IGL01678:Frmpd1 APN 4 45243717 missense probably damaging 1.00
IGL01815:Frmpd1 APN 4 45284239 missense probably benign
IGL02305:Frmpd1 APN 4 45249209 missense probably damaging 1.00
IGL02347:Frmpd1 APN 4 45270023 splice site probably null
IGL02586:Frmpd1 APN 4 45285160 missense probably damaging 1.00
IGL02704:Frmpd1 APN 4 45285082 missense possibly damaging 0.83
IGL02942:Frmpd1 APN 4 45285493 missense probably damaging 0.99
IGL03353:Frmpd1 APN 4 45261926 missense probably damaging 1.00
IGL03355:Frmpd1 APN 4 45279140 missense probably damaging 1.00
IGL03401:Frmpd1 APN 4 45284383 missense probably benign 0.28
IGL03047:Frmpd1 UTSW 4 45283993 missense probably damaging 1.00
R0094:Frmpd1 UTSW 4 45284899 nonsense probably null
R0103:Frmpd1 UTSW 4 45229884 missense probably damaging 0.99
R0103:Frmpd1 UTSW 4 45229884 missense probably damaging 0.99
R0109:Frmpd1 UTSW 4 45279340 missense probably benign 0.03
R0109:Frmpd1 UTSW 4 45279340 missense probably benign 0.03
R0375:Frmpd1 UTSW 4 45284196 missense probably benign 0.00
R0508:Frmpd1 UTSW 4 45284938 missense unknown
R0524:Frmpd1 UTSW 4 45256902 missense probably damaging 1.00
R0524:Frmpd1 UTSW 4 45283774 missense probably benign 0.00
R0625:Frmpd1 UTSW 4 45284055 missense probably benign
R0825:Frmpd1 UTSW 4 45285394 missense possibly damaging 0.93
R0926:Frmpd1 UTSW 4 45268497 missense probably damaging 1.00
R0975:Frmpd1 UTSW 4 45279000 missense probably benign 0.01
R1465:Frmpd1 UTSW 4 45273197 missense probably damaging 1.00
R1465:Frmpd1 UTSW 4 45273197 missense probably damaging 1.00
R1573:Frmpd1 UTSW 4 45283932 missense probably benign 0.01
R1938:Frmpd1 UTSW 4 45283711 missense probably damaging 1.00
R2334:Frmpd1 UTSW 4 45285408 missense probably damaging 0.97
R2413:Frmpd1 UTSW 4 45278969 missense probably benign 0.02
R2760:Frmpd1 UTSW 4 45244667 missense possibly damaging 0.77
R3856:Frmpd1 UTSW 4 45283698 missense probably damaging 1.00
R3876:Frmpd1 UTSW 4 45284093 missense probably benign 0.01
R4080:Frmpd1 UTSW 4 45284382 missense probably benign
R4597:Frmpd1 UTSW 4 45274441 missense probably benign 0.12
R4714:Frmpd1 UTSW 4 45284785 missense probably benign 0.11
R4779:Frmpd1 UTSW 4 45229865 missense probably damaging 1.00
R4957:Frmpd1 UTSW 4 45273099 missense probably damaging 1.00
R5000:Frmpd1 UTSW 4 45261931 splice site probably null
R5041:Frmpd1 UTSW 4 45278878 missense probably damaging 1.00
R5228:Frmpd1 UTSW 4 45284322 missense probably damaging 0.98
R5413:Frmpd1 UTSW 4 45249196 missense probably benign 0.00
R5560:Frmpd1 UTSW 4 45243697 missense probably damaging 1.00
R6133:Frmpd1 UTSW 4 45284915 missense probably benign 0.01
R6158:Frmpd1 UTSW 4 45285401 missense probably damaging 1.00
R6329:Frmpd1 UTSW 4 45268551 missense possibly damaging 0.80
R6338:Frmpd1 UTSW 4 45274489 missense probably benign 0.00
R6544:Frmpd1 UTSW 4 45279024 missense probably damaging 1.00
R6728:Frmpd1 UTSW 4 45284664 missense probably benign
R6748:Frmpd1 UTSW 4 45274397 missense probably benign 0.08
R6798:Frmpd1 UTSW 4 45284850 missense probably benign 0.17
R6828:Frmpd1 UTSW 4 45275383 missense probably damaging 0.99
R7002:Frmpd1 UTSW 4 45284200 missense probably benign
R7258:Frmpd1 UTSW 4 45269974 missense possibly damaging 0.79
R7295:Frmpd1 UTSW 4 45285700 missense probably damaging 1.00
R7382:Frmpd1 UTSW 4 45278880 missense probably benign 0.00
R7423:Frmpd1 UTSW 4 45256948 missense probably damaging 1.00
R7451:Frmpd1 UTSW 4 45279558 missense probably benign 0.11
R7492:Frmpd1 UTSW 4 45285237 missense possibly damaging 0.71
R7524:Frmpd1 UTSW 4 45271181 missense probably benign 0.16
R7610:Frmpd1 UTSW 4 45279098 missense probably damaging 1.00
R7719:Frmpd1 UTSW 4 45284841 missense possibly damaging 0.52
R7724:Frmpd1 UTSW 4 45229888 missense probably damaging 1.00
R7891:Frmpd1 UTSW 4 45284478 missense probably benign 0.06
R8260:Frmpd1 UTSW 4 45244638 missense probably damaging 0.99
Z1088:Frmpd1 UTSW 4 45284080 missense possibly damaging 0.93
Z1177:Frmpd1 UTSW 4 45275272 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCAACCCAGGTTCTTCCAG -3'
(R):5'- AGGGCCATTTCTGTGCATAAC -3'

Sequencing Primer
(F):5'- AGGTTCTTCCAGCCCACAG -3'
(R):5'- TGTACCTCATCTGCAGCCAAGG -3'
Posted On2020-01-23