Mutagenetix > Incidental Mutation

Incidental Mutation 'R8010:AI314180'

616844

Institutional Source

Beutler Lab

Gene Symbol

AI314180

Ensembl Gene

ENSMUSG00000050812

Gene Name

expressed sequence AI314180

Synonyms

MMRRC Submission

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.468) question?

Stock #

R8010 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

58798911-58912749 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 58832681 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Leucine at position 893 (Q893L)

Ref Sequence

ENSEMBL: ENSMUSP00000103182 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000102889] [ENSMUST00000107557] [ENSMUST00000149301]

AlphaFold

Q6PDI5

Predicted Effect

probably benign
Transcript: ENSMUST00000102889

SMART Domains

Protein: ENSMUSP00000099953
Gene: ENSMUSG00000050812

Domain	Start	End	E-Value	Type
Pfam:Ecm29	10	517	1.1e-155	PFAM
low complexity region	627	642	N/A	INTRINSIC
low complexity region	653	665	N/A	INTRINSIC
SCOP:d1qbkb_	693	1491	3e-31	SMART
low complexity region	1781	1797	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000107557
AA Change: Q893L

SMART Domains

Protein: ENSMUSP00000103182
Gene: ENSMUSG00000050812
AA Change: Q893L

Domain	Start	End	E-Value	Type
Pfam:Ecm29	10	517	7.6e-164	PFAM
low complexity region	627	642	N/A	INTRINSIC
low complexity region	653	665	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000149301

SMART Domains

Protein: ENSMUSP00000117585
Gene: ENSMUSG00000050812

Domain	Start	End	E-Value	Type
Pfam:Ecm29	10	517	4e-163	PFAM
low complexity region	627	642	N/A	INTRINSIC
low complexity region	653	665	N/A	INTRINSIC
SCOP:d1qbkb_	693	1490	8e-32	SMART

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.4%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A2ml1	T	A	6: 128,580,340	H130L	probably benign	Het
Abca1	A	G	4: 53,127,600	S140P	probably benign	Het
Aoc1	T	C	6: 48,905,648	Y153H	probably benign	Het
Arhgdib	A	G	6: 136,926,722	I118T	probably damaging	Het
Atp1a3	T	A	7: 24,980,645	E865V	possibly damaging	Het
Atrnl1	T	C	19: 57,682,446	V587A	probably benign	Het
C130026I21Rik	G	A	1: 85,246,950	S288L	possibly damaging	Het
Ccdc107	G	T	4: 43,495,768	E199*	probably null	Het
Cd55	A	T	1: 130,459,616	D148E	probably benign	Het
Cdc42ep1	C	T	15: 78,847,799	T148I	possibly damaging	Het
Cep164	A	T	9: 45,823,671	D19E	unknown	Het
Chsy3	A	G	18: 59,410,154	Y788C	probably damaging	Het
Cttnbp2	G	C	6: 18,426,093	A762G	possibly damaging	Het
Cubn	A	G	2: 13,336,086		probably null	Het
Ddr1	T	A	17: 35,691,492	M175L	possibly damaging	Het
Dicer1	C	A	12: 104,692,132	K1850N	probably damaging	Het
Dnajc6	C	T	4: 101,618,414	R495C	probably benign	Het
Fbxo18	A	T	2: 11,767,632	N79K	probably benign	Het
Frmpd1	T	A	4: 45,284,272	V1031D	possibly damaging	Het
Gm7298	A	G	6: 121,735,583	E118G	probably benign	Het
Hnrnpll	T	C	17: 80,061,956	T13A	unknown	Het
Jcad	A	G	18: 4,674,581	D781G	probably benign	Het
Kitl	A	T	10: 100,051,903	T25S	probably benign	Het
Krt5	T	C	15: 101,712,356	D152G	probably damaging	Het
Krtap5-5	T	C	7: 142,229,911	M1V	probably null	Het
Ktn1	C	T	14: 47,705,773	T862I	possibly damaging	Het
Mapk4	A	T	18: 73,930,576	I525N	probably benign	Het
Megf6	T	C	4: 154,270,507	F1457S	probably benign	Het
Mrm3	A	T	11: 76,250,347	S394C	probably damaging	Het
Mtmr4	T	G	11: 87,598,864	V71G	probably damaging	Het
Nek8	T	C	11: 78,176,596	Y4C	probably damaging	Het
Olfr203	T	C	16: 59,303,504	M117T	probably damaging	Het
Olfr309	T	A	7: 86,307,052	E20D	probably benign	Het
Olfr849	A	T	9: 19,441,692	I260L	probably benign	Het
Pla2r1	T	C	2: 60,514,960	T351A	probably benign	Het
Plcb4	C	T	2: 135,907,560	T49M	probably benign	Het
Psg20	T	C	7: 18,681,067	D301G	probably benign	Het
Ptpn13	C	T	5: 103,559,937	Q1455*	probably null	Het
Rbbp8	A	T	18: 11,722,233	N505I	possibly damaging	Het
Rgs18	A	G	1: 144,756,000	C125R	probably benign	Het
Rpap2	G	A	5: 107,603,605	C105Y	probably damaging	Het
Scn10a	C	T	9: 119,661,167	G570R	possibly damaging	Het
Sell	C	T	1: 164,065,512	T99I	possibly damaging	Het
Slc14a1	A	T	18: 78,116,489	M63K	probably benign	Het
Syne2	A	T	12: 75,930,738	D1319V	probably benign	Het
Tdp2	C	T	13: 24,836,027	T99I	probably damaging	Het
Tet3	A	T	6: 83,403,246	S647T	unknown	Het
Tpd52l1	T	G	10: 31,358,013	D48A	possibly damaging	Het
Ttll10	T	C	4: 156,047,161	D169G	probably damaging	Het
Wars2	C	A	3: 99,216,830	L336I	probably benign	Het
Wdfy4	C	A	14: 32,971,627	W2906L		Het
Xdh	A	T	17: 73,909,317	Y711*	probably null	Het
Xirp1	T	A	9: 120,017,824	R664S	probably benign	Het

Other mutations in AI314180

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00799:AI314180	APN	4	58828047	missense	possibly damaging	0.95
IGL01145:AI314180	APN	4	58811501	missense	probably null	0.08
IGL01371:AI314180	APN	4	58809718	missense	probably damaging	1.00
IGL01445:AI314180	APN	4	58833988	missense	probably benign	0.08
IGL01452:AI314180	APN	4	58836181	missense	probably damaging	0.99
IGL01626:AI314180	APN	4	58832814	splice site	probably benign
IGL01672:AI314180	APN	4	58814041	missense	probably benign	0.40
IGL01943:AI314180	APN	4	58849937	missense	possibly damaging	0.91
IGL01944:AI314180	APN	4	58861544	missense	probably benign	0.42
IGL02190:AI314180	APN	4	58800190	missense	probably benign	0.12
IGL02272:AI314180	APN	4	58811731	missense	probably benign	0.00
IGL02435:AI314180	APN	4	58830325	splice site	probably benign
IGL02516:AI314180	APN	4	58877102	missense	probably damaging	1.00
IGL02540:AI314180	APN	4	58805534	splice site	probably benign
IGL02709:AI314180	APN	4	58872699	missense	possibly damaging	0.90
IGL02742:AI314180	APN	4	58840757	missense	probably damaging	0.96
IGL02812:AI314180	APN	4	58864343	splice site	probably benign
IGL02828:AI314180	APN	4	58875512	missense	possibly damaging	0.59
IGL03130:AI314180	APN	4	58800288	missense	probably benign
IGL03179:AI314180	APN	4	58832777	missense	probably damaging	1.00
IGL03237:AI314180	APN	4	58810668	missense	probably benign	0.40
IGL03344:AI314180	APN	4	58828538	missense	probably damaging	1.00
boone	UTSW	4	58877157	missense	probably damaging	1.00
Crockett	UTSW	4	58879100	missense	probably damaging	1.00
frontiersman	UTSW	4	58832753	missense	probably benign
BB006:AI314180	UTSW	4	58869554	missense	probably damaging	1.00
BB016:AI314180	UTSW	4	58869554	missense	probably damaging	1.00
R0051:AI314180	UTSW	4	58832729	missense	probably damaging	1.00
R0051:AI314180	UTSW	4	58832729	missense	probably damaging	1.00
R0313:AI314180	UTSW	4	58811892	missense	probably benign	0.11
R0399:AI314180	UTSW	4	58827047	missense	possibly damaging	0.69
R0487:AI314180	UTSW	4	58819155	missense	probably damaging	1.00
R0492:AI314180	UTSW	4	58864418	missense	probably damaging	1.00
R0705:AI314180	UTSW	4	58885366	critical splice donor site	probably null
R0847:AI314180	UTSW	4	58841439	missense	probably benign	0.14
R1467:AI314180	UTSW	4	58832753	missense	probably benign
R1467:AI314180	UTSW	4	58832753	missense	probably benign
R1482:AI314180	UTSW	4	58820163	missense	possibly damaging	0.85
R1529:AI314180	UTSW	4	58832701	splice site	probably null
R1771:AI314180	UTSW	4	58879100	missense	probably damaging	1.00
R1776:AI314180	UTSW	4	58879100	missense	probably damaging	1.00
R1822:AI314180	UTSW	4	58805539	critical splice donor site	probably null
R1864:AI314180	UTSW	4	58849942	missense	possibly damaging	0.62
R2029:AI314180	UTSW	4	58844165	nonsense	probably null
R2061:AI314180	UTSW	4	58824270	missense	probably damaging	1.00
R2125:AI314180	UTSW	4	58833978	missense	probably benign
R2266:AI314180	UTSW	4	58830332	critical splice donor site	probably null
R2889:AI314180	UTSW	4	58836165	missense	probably benign
R2902:AI314180	UTSW	4	58809691	missense	probably benign	0.31
R2903:AI314180	UTSW	4	58828622	missense	possibly damaging	0.50
R2925:AI314180	UTSW	4	58833928	nonsense	probably null
R4151:AI314180	UTSW	4	58836254	missense	possibly damaging	0.51
R4225:AI314180	UTSW	4	58847027	missense	probably damaging	1.00
R4486:AI314180	UTSW	4	58820086	intron	probably benign
R4576:AI314180	UTSW	4	58834708	intron	probably benign
R4580:AI314180	UTSW	4	58840751	missense	probably damaging	1.00
R4654:AI314180	UTSW	4	58834523	missense	possibly damaging	0.86
R4688:AI314180	UTSW	4	58840757	missense	probably damaging	0.96
R4726:AI314180	UTSW	4	58844191	missense	probably damaging	1.00
R4825:AI314180	UTSW	4	58850911	missense	probably damaging	0.99
R4928:AI314180	UTSW	4	58827073	missense	probably damaging	1.00
R5098:AI314180	UTSW	4	58877048	missense	probably damaging	1.00
R5284:AI314180	UTSW	4	58836172	missense	possibly damaging	0.90
R5375:AI314180	UTSW	4	58809401	nonsense	probably null
R5382:AI314180	UTSW	4	58850934	missense	probably benign	0.38
R5487:AI314180	UTSW	4	58809421	missense	probably benign	0.22
R5703:AI314180	UTSW	4	58877171	splice site	probably null
R5761:AI314180	UTSW	4	58853131	missense	probably damaging	1.00
R5791:AI314180	UTSW	4	58814027	missense	possibly damaging	0.90
R5791:AI314180	UTSW	4	58822111	missense	probably damaging	1.00
R5928:AI314180	UTSW	4	58849948	missense	possibly damaging	0.59
R6062:AI314180	UTSW	4	58826453	missense	possibly damaging	0.84
R6246:AI314180	UTSW	4	58811365	splice site	probably null
R6298:AI314180	UTSW	4	58877157	missense	probably damaging	1.00
R6326:AI314180	UTSW	4	58827068	missense	probably benign	0.34
R6478:AI314180	UTSW	4	58810785	missense	probably damaging	1.00
R6707:AI314180	UTSW	4	58879101	missense	possibly damaging	0.52
R6846:AI314180	UTSW	4	58814081	missense	possibly damaging	0.85
R6857:AI314180	UTSW	4	58814065	missense	probably damaging	1.00
R6951:AI314180	UTSW	4	58853114	critical splice donor site	probably null
R7088:AI314180	UTSW	4	58849766	missense	possibly damaging	0.93
R7302:AI314180	UTSW	4	58834593	missense	probably benign	0.43
R7337:AI314180	UTSW	4	58827047	missense	possibly damaging	0.69
R7341:AI314180	UTSW	4	58809415	missense	possibly damaging	0.94
R7344:AI314180	UTSW	4	58824770	missense	probably benign	0.08
R7525:AI314180	UTSW	4	58847038	missense	possibly damaging	0.84
R7530:AI314180	UTSW	4	58815317	missense	probably damaging	0.99
R7533:AI314180	UTSW	4	58809411	missense	probably benign	0.12
R7557:AI314180	UTSW	4	58849691	missense	possibly damaging	0.85
R7698:AI314180	UTSW	4	58832660	missense	unknown
R7793:AI314180	UTSW	4	58853150	missense	probably damaging	1.00
R7892:AI314180	UTSW	4	58828593	missense	probably benign
R7894:AI314180	UTSW	4	58853708	missense	probably damaging	1.00
R7929:AI314180	UTSW	4	58869554	missense	probably damaging	1.00
R8082:AI314180	UTSW	4	58807852	missense	probably benign	0.00
R8175:AI314180	UTSW	4	58872756	missense	probably damaging	1.00
R8191:AI314180	UTSW	4	58872587	critical splice donor site	probably null
R8326:AI314180	UTSW	4	58847093	missense	probably damaging	1.00
R8459:AI314180	UTSW	4	58821379	missense	probably damaging	1.00
R8683:AI314180	UTSW	4	58834515	missense	probably benign	0.31
R8747:AI314180	UTSW	4	58828632	missense	probably damaging	0.98
R8981:AI314180	UTSW	4	58801796	missense	probably benign
R9206:AI314180	UTSW	4	58875444	missense	probably damaging	1.00
R9208:AI314180	UTSW	4	58875444	missense	probably damaging	1.00
R9231:AI314180	UTSW	4	58875533	missense	probably damaging	1.00
R9249:AI314180	UTSW	4	58869427	missense	probably damaging	1.00
R9355:AI314180	UTSW	4	58844114	missense	probably benign	0.23
R9534:AI314180	UTSW	4	58807867	missense	probably benign
R9555:AI314180	UTSW	4	58879083	missense	not run
R9570:AI314180	UTSW	4	58832796	nonsense	probably null
X0060:AI314180	UTSW	4	58840752	missense	possibly damaging	0.73
Z1177:AI314180	UTSW	4	58861614	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- GCGGCAGCAGCGAAATTAA -3'
(R):5'- TGGGAGTACTGTTTTGAAATAAAGC -3'

Sequencing Primer
(F):5'- GATATTCCTGAGATAGCTGACCGC -3'
(R):5'- CAATCCAAACACTGGGCT -3'

Posted On

2020-01-23