Incidental Mutation 'R8010:AI314180'
ID616844
Institutional Source Beutler Lab
Gene Symbol AI314180
Ensembl Gene ENSMUSG00000050812
Gene Nameexpressed sequence AI314180
Synonyms
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.371) question?
Stock #R8010 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location58798911-58912749 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 58832681 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 893 (Q893L)
Ref Sequence ENSEMBL: ENSMUSP00000103182 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102889] [ENSMUST00000107557] [ENSMUST00000149301]
Predicted Effect probably benign
Transcript: ENSMUST00000102889
SMART Domains Protein: ENSMUSP00000099953
Gene: ENSMUSG00000050812

DomainStartEndE-ValueType
Pfam:Ecm29 10 517 1.1e-155 PFAM
low complexity region 627 642 N/A INTRINSIC
low complexity region 653 665 N/A INTRINSIC
SCOP:d1qbkb_ 693 1491 3e-31 SMART
low complexity region 1781 1797 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000107557
AA Change: Q893L
SMART Domains Protein: ENSMUSP00000103182
Gene: ENSMUSG00000050812
AA Change: Q893L

DomainStartEndE-ValueType
Pfam:Ecm29 10 517 7.6e-164 PFAM
low complexity region 627 642 N/A INTRINSIC
low complexity region 653 665 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000149301
SMART Domains Protein: ENSMUSP00000117585
Gene: ENSMUSG00000050812

DomainStartEndE-ValueType
Pfam:Ecm29 10 517 4e-163 PFAM
low complexity region 627 642 N/A INTRINSIC
low complexity region 653 665 N/A INTRINSIC
SCOP:d1qbkb_ 693 1490 8e-32 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 T A 6: 128,580,340 H130L probably benign Het
Abca1 A G 4: 53,127,600 S140P probably benign Het
Aoc1 T C 6: 48,905,648 Y153H probably benign Het
Arhgdib A G 6: 136,926,722 I118T probably damaging Het
Atp1a3 T A 7: 24,980,645 E865V possibly damaging Het
Atrnl1 T C 19: 57,682,446 V587A probably benign Het
C130026I21Rik G A 1: 85,246,950 S288L possibly damaging Het
Ccdc107 G T 4: 43,495,768 E199* probably null Het
Cd55 A T 1: 130,459,616 D148E probably benign Het
Cdc42ep1 C T 15: 78,847,799 T148I possibly damaging Het
Cep164 A T 9: 45,823,671 D19E unknown Het
Chsy3 A G 18: 59,410,154 Y788C probably damaging Het
Cttnbp2 G C 6: 18,426,093 A762G possibly damaging Het
Cubn A G 2: 13,336,086 probably null Het
Ddr1 T A 17: 35,691,492 M175L possibly damaging Het
Dicer1 C A 12: 104,692,132 K1850N probably damaging Het
Dnajc6 C T 4: 101,618,414 R495C probably benign Het
Fbxo18 A T 2: 11,767,632 N79K probably benign Het
Frmpd1 T A 4: 45,284,272 V1031D possibly damaging Het
Gm7298 A G 6: 121,735,583 E118G probably benign Het
Hnrnpll T C 17: 80,061,956 T13A unknown Het
Jcad A G 18: 4,674,581 D781G probably benign Het
Kitl A T 10: 100,051,903 T25S probably benign Het
Krt5 T C 15: 101,712,356 D152G probably damaging Het
Krtap5-5 T C 7: 142,229,911 M1V probably null Het
Ktn1 C T 14: 47,705,773 T862I possibly damaging Het
Mapk4 A T 18: 73,930,576 I525N probably benign Het
Megf6 T C 4: 154,270,507 F1457S probably benign Het
Mrm3 A T 11: 76,250,347 S394C probably damaging Het
Mtmr4 T G 11: 87,598,864 V71G probably damaging Het
Nek8 T C 11: 78,176,596 Y4C probably damaging Het
Olfr203 T C 16: 59,303,504 M117T probably damaging Het
Olfr309 T A 7: 86,307,052 E20D probably benign Het
Olfr849 A T 9: 19,441,692 I260L probably benign Het
Pla2r1 T C 2: 60,514,960 T351A probably benign Het
Plcb4 C T 2: 135,907,560 T49M probably benign Het
Psg20 T C 7: 18,681,067 D301G probably benign Het
Ptpn13 C T 5: 103,559,937 Q1455* probably null Het
Rbbp8 A T 18: 11,722,233 N505I possibly damaging Het
Rgs18 A G 1: 144,756,000 C125R probably benign Het
Rpap2 G A 5: 107,603,605 C105Y probably damaging Het
Scn10a C T 9: 119,661,167 G570R possibly damaging Het
Sell C T 1: 164,065,512 T99I possibly damaging Het
Slc14a1 A T 18: 78,116,489 M63K probably benign Het
Syne2 A T 12: 75,930,738 D1319V probably benign Het
Tdp2 C T 13: 24,836,027 T99I probably damaging Het
Tet3 A T 6: 83,403,246 S647T unknown Het
Tpd52l1 T G 10: 31,358,013 D48A possibly damaging Het
Ttll10 T C 4: 156,047,161 D169G probably damaging Het
Wars2 C A 3: 99,216,830 L336I probably benign Het
Wdfy4 C A 14: 32,971,627 W2906L Het
Xdh A T 17: 73,909,317 Y711* probably null Het
Xirp1 T A 9: 120,017,824 R664S probably benign Het
Other mutations in AI314180
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00799:AI314180 APN 4 58828047 missense possibly damaging 0.95
IGL01145:AI314180 APN 4 58811501 missense probably null 0.08
IGL01371:AI314180 APN 4 58809718 missense probably damaging 1.00
IGL01445:AI314180 APN 4 58833988 missense probably benign 0.08
IGL01452:AI314180 APN 4 58836181 missense probably damaging 0.99
IGL01626:AI314180 APN 4 58832814 splice site probably benign
IGL01672:AI314180 APN 4 58814041 missense probably benign 0.40
IGL01943:AI314180 APN 4 58849937 missense possibly damaging 0.91
IGL01944:AI314180 APN 4 58861544 missense probably benign 0.42
IGL02190:AI314180 APN 4 58800190 missense probably benign 0.12
IGL02272:AI314180 APN 4 58811731 missense probably benign 0.00
IGL02435:AI314180 APN 4 58830325 splice site probably benign
IGL02516:AI314180 APN 4 58877102 missense probably damaging 1.00
IGL02540:AI314180 APN 4 58805534 splice site probably benign
IGL02709:AI314180 APN 4 58872699 missense possibly damaging 0.90
IGL02742:AI314180 APN 4 58840757 missense probably damaging 0.96
IGL02812:AI314180 APN 4 58864343 splice site probably benign
IGL02828:AI314180 APN 4 58875512 missense possibly damaging 0.59
IGL03130:AI314180 APN 4 58800288 missense probably benign
IGL03179:AI314180 APN 4 58832777 missense probably damaging 1.00
IGL03237:AI314180 APN 4 58810668 missense probably benign 0.40
IGL03344:AI314180 APN 4 58828538 missense probably damaging 1.00
BB006:AI314180 UTSW 4 58869554 missense not run
BB016:AI314180 UTSW 4 58869554 missense not run
R0051:AI314180 UTSW 4 58832729 missense probably damaging 1.00
R0051:AI314180 UTSW 4 58832729 missense probably damaging 1.00
R0313:AI314180 UTSW 4 58811892 missense probably benign 0.11
R0399:AI314180 UTSW 4 58827047 missense possibly damaging 0.69
R0487:AI314180 UTSW 4 58819155 missense probably damaging 1.00
R0492:AI314180 UTSW 4 58864418 missense probably damaging 1.00
R0705:AI314180 UTSW 4 58885366 critical splice donor site probably null
R0847:AI314180 UTSW 4 58841439 missense probably benign 0.14
R1467:AI314180 UTSW 4 58832753 missense probably benign
R1467:AI314180 UTSW 4 58832753 missense probably benign
R1482:AI314180 UTSW 4 58820163 missense possibly damaging 0.85
R1529:AI314180 UTSW 4 58832701 splice site probably null
R1771:AI314180 UTSW 4 58879100 missense probably damaging 1.00
R1776:AI314180 UTSW 4 58879100 missense probably damaging 1.00
R1822:AI314180 UTSW 4 58805539 critical splice donor site probably null
R1864:AI314180 UTSW 4 58849942 missense possibly damaging 0.62
R2029:AI314180 UTSW 4 58844165 nonsense probably null
R2061:AI314180 UTSW 4 58824270 missense probably damaging 1.00
R2125:AI314180 UTSW 4 58833978 missense probably benign
R2266:AI314180 UTSW 4 58830332 critical splice donor site probably null
R2889:AI314180 UTSW 4 58836165 missense probably benign
R2902:AI314180 UTSW 4 58809691 missense probably benign 0.31
R2903:AI314180 UTSW 4 58828622 missense possibly damaging 0.50
R2925:AI314180 UTSW 4 58833928 nonsense probably null
R4151:AI314180 UTSW 4 58836254 missense possibly damaging 0.51
R4225:AI314180 UTSW 4 58847027 missense probably damaging 1.00
R4486:AI314180 UTSW 4 58820086 intron probably benign
R4576:AI314180 UTSW 4 58834708 intron probably benign
R4580:AI314180 UTSW 4 58840751 missense probably damaging 1.00
R4654:AI314180 UTSW 4 58834523 missense possibly damaging 0.86
R4688:AI314180 UTSW 4 58840757 missense probably damaging 0.96
R4726:AI314180 UTSW 4 58844191 missense probably damaging 1.00
R4825:AI314180 UTSW 4 58850911 missense probably damaging 0.99
R4928:AI314180 UTSW 4 58827073 missense probably damaging 1.00
R5098:AI314180 UTSW 4 58877048 missense probably damaging 1.00
R5284:AI314180 UTSW 4 58836172 missense possibly damaging 0.90
R5375:AI314180 UTSW 4 58809401 nonsense probably null
R5382:AI314180 UTSW 4 58850934 missense probably benign 0.38
R5487:AI314180 UTSW 4 58809421 missense probably benign 0.22
R5703:AI314180 UTSW 4 58877171 splice site probably null
R5761:AI314180 UTSW 4 58853131 missense probably damaging 1.00
R5791:AI314180 UTSW 4 58814027 missense possibly damaging 0.90
R5791:AI314180 UTSW 4 58822111 missense probably damaging 1.00
R5928:AI314180 UTSW 4 58849948 missense possibly damaging 0.59
R6062:AI314180 UTSW 4 58826453 missense possibly damaging 0.84
R6246:AI314180 UTSW 4 58811365 splice site probably null
R6298:AI314180 UTSW 4 58877157 missense probably damaging 1.00
R6326:AI314180 UTSW 4 58827068 missense probably benign 0.34
R6478:AI314180 UTSW 4 58810785 missense probably damaging 1.00
R6707:AI314180 UTSW 4 58879101 missense possibly damaging 0.52
R6846:AI314180 UTSW 4 58814081 missense possibly damaging 0.85
R6857:AI314180 UTSW 4 58814065 missense probably damaging 1.00
R6951:AI314180 UTSW 4 58853114 critical splice donor site probably null
R7088:AI314180 UTSW 4 58849766 missense possibly damaging 0.93
R7302:AI314180 UTSW 4 58834593 missense probably benign 0.43
R7337:AI314180 UTSW 4 58827047 missense possibly damaging 0.69
R7341:AI314180 UTSW 4 58809415 missense possibly damaging 0.94
R7344:AI314180 UTSW 4 58824770 missense probably benign 0.08
R7525:AI314180 UTSW 4 58847038 missense possibly damaging 0.84
R7530:AI314180 UTSW 4 58815317 missense probably damaging 0.99
R7533:AI314180 UTSW 4 58809411 missense probably benign 0.12
R7557:AI314180 UTSW 4 58849691 missense possibly damaging 0.85
R7698:AI314180 UTSW 4 58832660 missense unknown
R7793:AI314180 UTSW 4 58853150 missense probably damaging 1.00
R7892:AI314180 UTSW 4 58828593 missense probably benign
R7894:AI314180 UTSW 4 58853708 missense probably damaging 1.00
R7975:AI314180 UTSW 4 58828593 missense probably benign
R7977:AI314180 UTSW 4 58853708 missense probably damaging 1.00
R8082:AI314180 UTSW 4 58807852 missense probably benign 0.00
R8175:AI314180 UTSW 4 58872756 missense probably damaging 1.00
R8191:AI314180 UTSW 4 58872587 critical splice donor site probably null
X0060:AI314180 UTSW 4 58840752 missense possibly damaging 0.73
Z1177:AI314180 UTSW 4 58861614 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCGGCAGCAGCGAAATTAA -3'
(R):5'- TGGGAGTACTGTTTTGAAATAAAGC -3'

Sequencing Primer
(F):5'- GATATTCCTGAGATAGCTGACCGC -3'
(R):5'- CAATCCAAACACTGGGCT -3'
Posted On2020-01-23