Incidental Mutation 'R8010:Arhgdib'
ID616855
Institutional Source Beutler Lab
Gene Symbol Arhgdib
Ensembl Gene ENSMUSG00000030220
Gene NameRho, GDP dissociation inhibitor (GDI) beta
SynonymsLy-GDI, D4, Gdid4
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8010 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location136923655-136941899 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 136926722 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 118 (I118T)
Ref Sequence ENSEMBL: ENSMUSP00000032344 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032343] [ENSMUST00000032344] [ENSMUST00000111891] [ENSMUST00000111892] [ENSMUST00000204627] [ENSMUST00000204934]
Predicted Effect probably benign
Transcript: ENSMUST00000032343
SMART Domains Protein: ENSMUSP00000032343
Gene: ENSMUSG00000030219

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
low complexity region 48 61 N/A INTRINSIC
Pfam:Thioredoxin_6 64 251 2.8e-43 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000032344
AA Change: I118T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000032344
Gene: ENSMUSG00000030220
AA Change: I118T

DomainStartEndE-ValueType
Pfam:Rho_GDI 1 197 4e-94 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000111891
AA Change: I118T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107522
Gene: ENSMUSG00000030220
AA Change: I118T

DomainStartEndE-ValueType
Pfam:Rho_GDI 6 197 5.3e-79 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000111892
AA Change: I118T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107523
Gene: ENSMUSG00000030220
AA Change: I118T

DomainStartEndE-ValueType
Pfam:Rho_GDI 1 197 4e-94 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000204627
SMART Domains Protein: ENSMUSP00000145191
Gene: ENSMUSG00000064330

DomainStartEndE-ValueType
Pfam:PDE6_gamma 2 74 1.5e-41 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000204934
AA Change: I35T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000145103
Gene: ENSMUSG00000030220
AA Change: I35T

DomainStartEndE-ValueType
Pfam:Rho_GDI 1 89 1.5e-38 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the Rho guanine nucleotide dissociation inhibitor (GDI) family. This gene is expressed at high levels in hematopoietic cells. This protein is cytosolic, and dissociation of Rho from this protein is required for membrane association and activation of Rho by Guanine Nucleotide Exchange Factors (GEFs). C-terminal truncations of this gene product have been reported to promote metastasis. Multiple transcript variants and protein isoforms exist. [provided by RefSeq, Aug 2014]
PHENOTYPE: A homozygous null mutation results in mice that are viable and fertile. Immune responses are similar to controls in mice, but in vitro analysis demonstrated an increased B cell proliferative response upon lectin stimulation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 T A 6: 128,580,340 H130L probably benign Het
Abca1 A G 4: 53,127,600 S140P probably benign Het
AI314180 T A 4: 58,832,681 Q893L unknown Het
Aoc1 T C 6: 48,905,648 Y153H probably benign Het
Atp1a3 T A 7: 24,980,645 E865V possibly damaging Het
Atrnl1 T C 19: 57,682,446 V587A probably benign Het
C130026I21Rik G A 1: 85,246,950 S288L possibly damaging Het
Ccdc107 G T 4: 43,495,768 E199* probably null Het
Cd55 A T 1: 130,459,616 D148E probably benign Het
Cdc42ep1 C T 15: 78,847,799 T148I possibly damaging Het
Cep164 A T 9: 45,823,671 D19E unknown Het
Chsy3 A G 18: 59,410,154 Y788C probably damaging Het
Cttnbp2 G C 6: 18,426,093 A762G possibly damaging Het
Cubn A G 2: 13,336,086 probably null Het
Ddr1 T A 17: 35,691,492 M175L possibly damaging Het
Dicer1 C A 12: 104,692,132 K1850N probably damaging Het
Dnajc6 C T 4: 101,618,414 R495C probably benign Het
Fbxo18 A T 2: 11,767,632 N79K probably benign Het
Frmpd1 T A 4: 45,284,272 V1031D possibly damaging Het
Gm7298 A G 6: 121,735,583 E118G probably benign Het
Hnrnpll T C 17: 80,061,956 T13A unknown Het
Jcad A G 18: 4,674,581 D781G probably benign Het
Kitl A T 10: 100,051,903 T25S probably benign Het
Krt5 T C 15: 101,712,356 D152G probably damaging Het
Krtap5-5 T C 7: 142,229,911 M1V probably null Het
Ktn1 C T 14: 47,705,773 T862I possibly damaging Het
Mapk4 A T 18: 73,930,576 I525N probably benign Het
Megf6 T C 4: 154,270,507 F1457S probably benign Het
Mrm3 A T 11: 76,250,347 S394C probably damaging Het
Mtmr4 T G 11: 87,598,864 V71G probably damaging Het
Nek8 T C 11: 78,176,596 Y4C probably damaging Het
Olfr203 T C 16: 59,303,504 M117T probably damaging Het
Olfr309 T A 7: 86,307,052 E20D probably benign Het
Olfr849 A T 9: 19,441,692 I260L probably benign Het
Pla2r1 T C 2: 60,514,960 T351A probably benign Het
Plcb4 C T 2: 135,907,560 T49M probably benign Het
Psg20 T C 7: 18,681,067 D301G probably benign Het
Ptpn13 C T 5: 103,559,937 Q1455* probably null Het
Rbbp8 A T 18: 11,722,233 N505I possibly damaging Het
Rgs18 A G 1: 144,756,000 C125R probably benign Het
Rpap2 G A 5: 107,603,605 C105Y probably damaging Het
Scn10a C T 9: 119,661,167 G570R possibly damaging Het
Sell C T 1: 164,065,512 T99I possibly damaging Het
Slc14a1 A T 18: 78,116,489 M63K probably benign Het
Syne2 A T 12: 75,930,738 D1319V probably benign Het
Tdp2 C T 13: 24,836,027 T99I probably damaging Het
Tet3 A T 6: 83,403,246 S647T unknown Het
Tpd52l1 T G 10: 31,358,013 D48A possibly damaging Het
Ttll10 T C 4: 156,047,161 D169G probably damaging Het
Wars2 C A 3: 99,216,830 L336I probably benign Het
Wdfy4 C A 14: 32,971,627 W2906L Het
Xdh A T 17: 73,909,317 Y711* probably null Het
Xirp1 T A 9: 120,017,824 R664S probably benign Het
Other mutations in Arhgdib
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01087:Arhgdib APN 6 136933624 missense probably damaging 1.00
IGL01712:Arhgdib APN 6 136924197 missense probably damaging 1.00
IGL02589:Arhgdib APN 6 136933578 intron probably benign
IGL02648:Arhgdib APN 6 136933649 missense probably damaging 1.00
IGL02682:Arhgdib APN 6 136924168 missense probably damaging 1.00
IGL03381:Arhgdib APN 6 136932316 missense probably benign 0.30
K7371:Arhgdib UTSW 6 136932299 splice site probably null
PIT4810001:Arhgdib UTSW 6 136924164 missense probably damaging 1.00
R0270:Arhgdib UTSW 6 136926734 missense probably damaging 1.00
R1755:Arhgdib UTSW 6 136929614 nonsense probably null
R4289:Arhgdib UTSW 6 136924158 missense probably benign 0.02
R5927:Arhgdib UTSW 6 136924138 missense probably damaging 1.00
R6364:Arhgdib UTSW 6 136932255 splice site probably null
R8031:Arhgdib UTSW 6 136924276 missense probably benign 0.10
Z1088:Arhgdib UTSW 6 136933618 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCATCTTGGTCTGATGTGCC -3'
(R):5'- GAGATTATTGCCCAAGCCACC -3'

Sequencing Primer
(F):5'- AGACATGCCATCTACCTGTACCTG -3'
(R):5'- GAGACACTGTTTTCATTAACACCGTC -3'
Posted On2020-01-23