Incidental Mutation 'R8010:Olfr309'
ID616858
Institutional Source Beutler Lab
Gene Symbol Olfr309
Ensembl Gene ENSMUSG00000054054
Gene Nameolfactory receptor 309
SynonymsGA_x6K02T2NHDJ-9801340-9802266, MOR251-4P
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #R8010 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location86304474-86313708 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 86307052 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 20 (E20D)
Ref Sequence ENSEMBL: ENSMUSP00000134377 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055690] [ENSMUST00000174158]
Predicted Effect probably benign
Transcript: ENSMUST00000055690
AA Change: E20D

PolyPhen 2 Score 0.236 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000061929
Gene: ENSMUSG00000054054
AA Change: E20D

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 33 303 4.5e-11 PFAM
Pfam:7tm_1 39 288 1.5e-26 PFAM
Pfam:7tm_4 137 281 7.9e-44 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174158
AA Change: E20D

PolyPhen 2 Score 0.236 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000134377
Gene: ENSMUSG00000054054
AA Change: E20D

DomainStartEndE-ValueType
Pfam:7tm_4 29 305 1.6e-55 PFAM
Pfam:7TM_GPCR_Srsx 33 303 4.5e-11 PFAM
Pfam:7tm_1 39 288 2.4e-18 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 T A 6: 128,580,340 H130L probably benign Het
Abca1 A G 4: 53,127,600 S140P probably benign Het
AI314180 T A 4: 58,832,681 Q893L unknown Het
Aoc1 T C 6: 48,905,648 Y153H probably benign Het
Arhgdib A G 6: 136,926,722 I118T probably damaging Het
Atp1a3 T A 7: 24,980,645 E865V possibly damaging Het
Atrnl1 T C 19: 57,682,446 V587A probably benign Het
C130026I21Rik G A 1: 85,246,950 S288L possibly damaging Het
Ccdc107 G T 4: 43,495,768 E199* probably null Het
Cd55 A T 1: 130,459,616 D148E probably benign Het
Cdc42ep1 C T 15: 78,847,799 T148I possibly damaging Het
Cep164 A T 9: 45,823,671 D19E unknown Het
Chsy3 A G 18: 59,410,154 Y788C probably damaging Het
Cttnbp2 G C 6: 18,426,093 A762G possibly damaging Het
Cubn A G 2: 13,336,086 probably null Het
Ddr1 T A 17: 35,691,492 M175L possibly damaging Het
Dicer1 C A 12: 104,692,132 K1850N probably damaging Het
Dnajc6 C T 4: 101,618,414 R495C probably benign Het
Fbxo18 A T 2: 11,767,632 N79K probably benign Het
Frmpd1 T A 4: 45,284,272 V1031D possibly damaging Het
Gm7298 A G 6: 121,735,583 E118G probably benign Het
Hnrnpll T C 17: 80,061,956 T13A unknown Het
Jcad A G 18: 4,674,581 D781G probably benign Het
Kitl A T 10: 100,051,903 T25S probably benign Het
Krt5 T C 15: 101,712,356 D152G probably damaging Het
Krtap5-5 T C 7: 142,229,911 M1V probably null Het
Ktn1 C T 14: 47,705,773 T862I possibly damaging Het
Mapk4 A T 18: 73,930,576 I525N probably benign Het
Megf6 T C 4: 154,270,507 F1457S probably benign Het
Mrm3 A T 11: 76,250,347 S394C probably damaging Het
Mtmr4 T G 11: 87,598,864 V71G probably damaging Het
Nek8 T C 11: 78,176,596 Y4C probably damaging Het
Olfr203 T C 16: 59,303,504 M117T probably damaging Het
Olfr849 A T 9: 19,441,692 I260L probably benign Het
Pla2r1 T C 2: 60,514,960 T351A probably benign Het
Plcb4 C T 2: 135,907,560 T49M probably benign Het
Psg20 T C 7: 18,681,067 D301G probably benign Het
Ptpn13 C T 5: 103,559,937 Q1455* probably null Het
Rbbp8 A T 18: 11,722,233 N505I possibly damaging Het
Rgs18 A G 1: 144,756,000 C125R probably benign Het
Rpap2 G A 5: 107,603,605 C105Y probably damaging Het
Scn10a C T 9: 119,661,167 G570R possibly damaging Het
Sell C T 1: 164,065,512 T99I possibly damaging Het
Slc14a1 A T 18: 78,116,489 M63K probably benign Het
Syne2 A T 12: 75,930,738 D1319V probably benign Het
Tdp2 C T 13: 24,836,027 T99I probably damaging Het
Tet3 A T 6: 83,403,246 S647T unknown Het
Tpd52l1 T G 10: 31,358,013 D48A possibly damaging Het
Ttll10 T C 4: 156,047,161 D169G probably damaging Het
Wars2 C A 3: 99,216,830 L336I probably benign Het
Wdfy4 C A 14: 32,971,627 W2906L Het
Xdh A T 17: 73,909,317 Y711* probably null Het
Xirp1 T A 9: 120,017,824 R664S probably benign Het
Other mutations in Olfr309
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00886:Olfr309 APN 7 86307051 missense probably damaging 1.00
R0370:Olfr309 UTSW 7 86306849 missense probably benign 0.42
R1869:Olfr309 UTSW 7 86306667 missense possibly damaging 0.96
R2047:Olfr309 UTSW 7 86306804 missense probably damaging 1.00
R3939:Olfr309 UTSW 7 86306229 missense probably benign 0.00
R4562:Olfr309 UTSW 7 86307152 start gained probably benign
R4640:Olfr309 UTSW 7 86307066 missense probably benign 0.01
R4811:Olfr309 UTSW 7 86306958 missense probably benign 0.41
R4867:Olfr309 UTSW 7 86306283 missense probably benign 0.00
R4954:Olfr309 UTSW 7 86306601 missense probably benign 0.01
R5784:Olfr309 UTSW 7 86306535 missense probably damaging 1.00
R6043:Olfr309 UTSW 7 86306339 missense probably damaging 0.97
R6498:Olfr309 UTSW 7 86307018 missense probably benign
R6849:Olfr309 UTSW 7 86307040 missense possibly damaging 0.54
R7238:Olfr309 UTSW 7 86306591 missense probably damaging 1.00
R7811:Olfr309 UTSW 7 86306346 missense probably damaging 1.00
R7917:Olfr309 UTSW 7 86306478 missense probably damaging 1.00
R8271:Olfr309 UTSW 7 86306754 missense probably benign 0.13
T0975:Olfr309 UTSW 7 86306284 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AAGAGCTGGGACATGCAACC -3'
(R):5'- CCCATCATAGAGAAACTTATGCTAC -3'

Sequencing Primer
(F):5'- TGGGACATGCAACCCCCATATG -3'
(R):5'- GTCTAACCACTCATGCATG -3'
Posted On2020-01-23