Incidental Mutation 'R8010:Cep164'
ID616861
Institutional Source Beutler Lab
Gene Symbol Cep164
Ensembl Gene ENSMUSG00000043987
Gene Namecentrosomal protein 164
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8010 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location45766946-45828691 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 45823671 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 19 (D19E)
Ref Sequence ENSEMBL: ENSMUSP00000149815 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000117194] [ENSMUST00000213154] [ENSMUST00000214868]
Predicted Effect probably damaging
Transcript: ENSMUST00000117194
AA Change: D19E

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000114053
Gene: ENSMUSG00000043987
AA Change: D19E

DomainStartEndE-ValueType
WW 57 89 1.99e-3 SMART
low complexity region 110 127 N/A INTRINSIC
low complexity region 189 201 N/A INTRINSIC
low complexity region 210 229 N/A INTRINSIC
low complexity region 362 375 N/A INTRINSIC
coiled coil region 511 735 N/A INTRINSIC
low complexity region 741 756 N/A INTRINSIC
coiled coil region 761 931 N/A INTRINSIC
low complexity region 956 962 N/A INTRINSIC
coiled coil region 1057 1084 N/A INTRINSIC
low complexity region 1095 1110 N/A INTRINSIC
low complexity region 1141 1168 N/A INTRINSIC
low complexity region 1185 1195 N/A INTRINSIC
low complexity region 1235 1248 N/A INTRINSIC
low complexity region 1309 1318 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000213154
AA Change: D19E
Predicted Effect possibly damaging
Transcript: ENSMUST00000214868
AA Change: D19E

PolyPhen 2 Score 0.892 (Sensitivity: 0.82; Specificity: 0.94)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a centrosomal protein involved in microtubule organization, DNA damage response, and chromosome segregation. The encoded protein is required for assembly of primary cilia and localizes to mature centrioles. Defects in this gene are a cause of nephronophthisis-related ciliopathies. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2012]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 T A 6: 128,580,340 H130L probably benign Het
Abca1 A G 4: 53,127,600 S140P probably benign Het
AI314180 T A 4: 58,832,681 Q893L unknown Het
Aoc1 T C 6: 48,905,648 Y153H probably benign Het
Arhgdib A G 6: 136,926,722 I118T probably damaging Het
Atp1a3 T A 7: 24,980,645 E865V possibly damaging Het
Atrnl1 T C 19: 57,682,446 V587A probably benign Het
C130026I21Rik G A 1: 85,246,950 S288L possibly damaging Het
Ccdc107 G T 4: 43,495,768 E199* probably null Het
Cd55 A T 1: 130,459,616 D148E probably benign Het
Cdc42ep1 C T 15: 78,847,799 T148I possibly damaging Het
Chsy3 A G 18: 59,410,154 Y788C probably damaging Het
Cttnbp2 G C 6: 18,426,093 A762G possibly damaging Het
Cubn A G 2: 13,336,086 probably null Het
Ddr1 T A 17: 35,691,492 M175L possibly damaging Het
Dicer1 C A 12: 104,692,132 K1850N probably damaging Het
Dnajc6 C T 4: 101,618,414 R495C probably benign Het
Fbxo18 A T 2: 11,767,632 N79K probably benign Het
Frmpd1 T A 4: 45,284,272 V1031D possibly damaging Het
Gm7298 A G 6: 121,735,583 E118G probably benign Het
Hnrnpll T C 17: 80,061,956 T13A unknown Het
Jcad A G 18: 4,674,581 D781G probably benign Het
Kitl A T 10: 100,051,903 T25S probably benign Het
Krt5 T C 15: 101,712,356 D152G probably damaging Het
Krtap5-5 T C 7: 142,229,911 M1V probably null Het
Ktn1 C T 14: 47,705,773 T862I possibly damaging Het
Mapk4 A T 18: 73,930,576 I525N probably benign Het
Megf6 T C 4: 154,270,507 F1457S probably benign Het
Mrm3 A T 11: 76,250,347 S394C probably damaging Het
Mtmr4 T G 11: 87,598,864 V71G probably damaging Het
Nek8 T C 11: 78,176,596 Y4C probably damaging Het
Olfr203 T C 16: 59,303,504 M117T probably damaging Het
Olfr309 T A 7: 86,307,052 E20D probably benign Het
Olfr849 A T 9: 19,441,692 I260L probably benign Het
Pla2r1 T C 2: 60,514,960 T351A probably benign Het
Plcb4 C T 2: 135,907,560 T49M probably benign Het
Psg20 T C 7: 18,681,067 D301G probably benign Het
Ptpn13 C T 5: 103,559,937 Q1455* probably null Het
Rbbp8 A T 18: 11,722,233 N505I possibly damaging Het
Rgs18 A G 1: 144,756,000 C125R probably benign Het
Rpap2 G A 5: 107,603,605 C105Y probably damaging Het
Scn10a C T 9: 119,661,167 G570R possibly damaging Het
Sell C T 1: 164,065,512 T99I possibly damaging Het
Slc14a1 A T 18: 78,116,489 M63K probably benign Het
Syne2 A T 12: 75,930,738 D1319V probably benign Het
Tdp2 C T 13: 24,836,027 T99I probably damaging Het
Tet3 A T 6: 83,403,246 S647T unknown Het
Tpd52l1 T G 10: 31,358,013 D48A possibly damaging Het
Ttll10 T C 4: 156,047,161 D169G probably damaging Het
Wars2 C A 3: 99,216,830 L336I probably benign Het
Wdfy4 C A 14: 32,971,627 W2906L Het
Xdh A T 17: 73,909,317 Y711* probably null Het
Xirp1 T A 9: 120,017,824 R664S probably benign Het
Other mutations in Cep164
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00983:Cep164 APN 9 45775256 missense possibly damaging 0.46
IGL01571:Cep164 APN 9 45794338 missense possibly damaging 0.82
IGL01985:Cep164 APN 9 45779606 missense probably damaging 1.00
IGL01989:Cep164 APN 9 45793015 splice site probably benign
IGL02130:Cep164 APN 9 45779792 missense possibly damaging 0.82
IGL02598:Cep164 APN 9 45770704 missense probably damaging 1.00
IGL03206:Cep164 APN 9 45802725 missense probably benign 0.00
R0063:Cep164 UTSW 9 45768618 missense possibly damaging 0.83
R0109:Cep164 UTSW 9 45771587 missense probably damaging 1.00
R0528:Cep164 UTSW 9 45776936 unclassified probably benign
R0532:Cep164 UTSW 9 45809826 nonsense probably null
R1445:Cep164 UTSW 9 45778900 missense possibly damaging 0.66
R1753:Cep164 UTSW 9 45792937 missense probably damaging 0.99
R1824:Cep164 UTSW 9 45778928 missense probably damaging 1.00
R1856:Cep164 UTSW 9 45775758 splice site probably null
R1858:Cep164 UTSW 9 45823640 splice site probably benign
R1900:Cep164 UTSW 9 45809825 missense probably damaging 1.00
R1911:Cep164 UTSW 9 45770806 missense probably benign 0.09
R2032:Cep164 UTSW 9 45771600 missense probably damaging 1.00
R2133:Cep164 UTSW 9 45803183 missense probably damaging 1.00
R2186:Cep164 UTSW 9 45768578 missense probably damaging 1.00
R2511:Cep164 UTSW 9 45775249 missense probably damaging 1.00
R4424:Cep164 UTSW 9 45779704 missense possibly damaging 0.92
R5126:Cep164 UTSW 9 45787424 critical splice donor site probably null
R5997:Cep164 UTSW 9 45769463 missense possibly damaging 0.92
R6186:Cep164 UTSW 9 45794109 missense probably damaging 0.98
R6357:Cep164 UTSW 9 45770884 missense probably damaging 1.00
R6385:Cep164 UTSW 9 45779783 missense probably damaging 0.99
R6632:Cep164 UTSW 9 45779790 missense possibly damaging 0.66
R6957:Cep164 UTSW 9 45772280 critical splice donor site probably null
R7310:Cep164 UTSW 9 45775366 missense probably damaging 1.00
R7420:Cep164 UTSW 9 45768542 missense probably benign 0.01
R7651:Cep164 UTSW 9 45773852 missense probably benign 0.18
R7918:Cep164 UTSW 9 45779688 critical splice donor site probably null
R7982:Cep164 UTSW 9 45778864 missense probably benign 0.40
R8391:Cep164 UTSW 9 45807193 missense unknown
X0024:Cep164 UTSW 9 45775863 critical splice donor site probably null
X0028:Cep164 UTSW 9 45770967 missense probably damaging 1.00
X0065:Cep164 UTSW 9 45774787 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- CATGGACCAACTCTATACTGGCAG -3'
(R):5'- TGTGACCCAGATGCTCTGTG -3'

Sequencing Primer
(F):5'- AAGCATCTGTGAGTCCAGTTCCAG -3'
(R):5'- GATGCTCTGTGACCCAACTCAG -3'
Posted On2020-01-23