Incidental Mutation 'R8010:Mrm3'
ID616866
Institutional Source Beutler Lab
Gene Symbol Mrm3
Ensembl Gene ENSMUSG00000038046
Gene Namemitochondrial rRNA methyltransferase 3
SynonymsRnmtl1, 4833420N02Rik, HC90
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8010 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location76243715-76250619 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 76250347 bp
ZygosityHeterozygous
Amino Acid Change Serine to Cysteine at position 394 (S394C)
Ref Sequence ENSEMBL: ENSMUSP00000042882 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040577]
Predicted Effect probably damaging
Transcript: ENSMUST00000040577
AA Change: S394C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000042882
Gene: ENSMUSG00000038046
AA Change: S394C

DomainStartEndE-ValueType
SpoU_sub_bind 124 195 1.99e-5 SMART
Pfam:SpoU_methylase 209 398 2.3e-24 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Efficient translation of mitochondrial-derived transcripts requires proper assembly of the large subunit of the mitochondrial ribosome. Central to the biogenesis of this large subunit is the A-loop of mitochondrial 16S rRNA, which is modified by three rRNA methyltransferases located near mtDNA nucleoids. The protein encoded by this gene methylates G(1370) of 16S rRNA, and this modification is necessary for proper ribosomal large subnit assembly. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2015]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 T A 6: 128,580,340 H130L probably benign Het
Abca1 A G 4: 53,127,600 S140P probably benign Het
AI314180 T A 4: 58,832,681 Q893L unknown Het
Aoc1 T C 6: 48,905,648 Y153H probably benign Het
Arhgdib A G 6: 136,926,722 I118T probably damaging Het
Atp1a3 T A 7: 24,980,645 E865V possibly damaging Het
Atrnl1 T C 19: 57,682,446 V587A probably benign Het
C130026I21Rik G A 1: 85,246,950 S288L possibly damaging Het
Ccdc107 G T 4: 43,495,768 E199* probably null Het
Cd55 A T 1: 130,459,616 D148E probably benign Het
Cdc42ep1 C T 15: 78,847,799 T148I possibly damaging Het
Cep164 A T 9: 45,823,671 D19E unknown Het
Chsy3 A G 18: 59,410,154 Y788C probably damaging Het
Cttnbp2 G C 6: 18,426,093 A762G possibly damaging Het
Cubn A G 2: 13,336,086 probably null Het
Ddr1 T A 17: 35,691,492 M175L possibly damaging Het
Dicer1 C A 12: 104,692,132 K1850N probably damaging Het
Dnajc6 C T 4: 101,618,414 R495C probably benign Het
Fbxo18 A T 2: 11,767,632 N79K probably benign Het
Frmpd1 T A 4: 45,284,272 V1031D possibly damaging Het
Gm7298 A G 6: 121,735,583 E118G probably benign Het
Hnrnpll T C 17: 80,061,956 T13A unknown Het
Jcad A G 18: 4,674,581 D781G probably benign Het
Kitl A T 10: 100,051,903 T25S probably benign Het
Krt5 T C 15: 101,712,356 D152G probably damaging Het
Krtap5-5 T C 7: 142,229,911 M1V probably null Het
Ktn1 C T 14: 47,705,773 T862I possibly damaging Het
Mapk4 A T 18: 73,930,576 I525N probably benign Het
Megf6 T C 4: 154,270,507 F1457S probably benign Het
Mtmr4 T G 11: 87,598,864 V71G probably damaging Het
Nek8 T C 11: 78,176,596 Y4C probably damaging Het
Olfr203 T C 16: 59,303,504 M117T probably damaging Het
Olfr309 T A 7: 86,307,052 E20D probably benign Het
Olfr849 A T 9: 19,441,692 I260L probably benign Het
Pla2r1 T C 2: 60,514,960 T351A probably benign Het
Plcb4 C T 2: 135,907,560 T49M probably benign Het
Psg20 T C 7: 18,681,067 D301G probably benign Het
Ptpn13 C T 5: 103,559,937 Q1455* probably null Het
Rbbp8 A T 18: 11,722,233 N505I possibly damaging Het
Rgs18 A G 1: 144,756,000 C125R probably benign Het
Rpap2 G A 5: 107,603,605 C105Y probably damaging Het
Scn10a C T 9: 119,661,167 G570R possibly damaging Het
Sell C T 1: 164,065,512 T99I possibly damaging Het
Slc14a1 A T 18: 78,116,489 M63K probably benign Het
Syne2 A T 12: 75,930,738 D1319V probably benign Het
Tdp2 C T 13: 24,836,027 T99I probably damaging Het
Tet3 A T 6: 83,403,246 S647T unknown Het
Tpd52l1 T G 10: 31,358,013 D48A possibly damaging Het
Ttll10 T C 4: 156,047,161 D169G probably damaging Het
Wars2 C A 3: 99,216,830 L336I probably benign Het
Wdfy4 C A 14: 32,971,627 W2906L Het
Xdh A T 17: 73,909,317 Y711* probably null Het
Xirp1 T A 9: 120,017,824 R664S probably benign Het
Other mutations in Mrm3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00425:Mrm3 APN 11 76244493 missense probably damaging 1.00
IGL02712:Mrm3 APN 11 76243857 missense possibly damaging 0.87
IGL03349:Mrm3 APN 11 76249946 missense probably damaging 1.00
P0026:Mrm3 UTSW 11 76247500 missense probably damaging 1.00
R0118:Mrm3 UTSW 11 76249955 missense possibly damaging 0.94
R1174:Mrm3 UTSW 11 76250024 missense probably damaging 1.00
R2066:Mrm3 UTSW 11 76250321 missense probably damaging 1.00
R2114:Mrm3 UTSW 11 76244521 missense possibly damaging 0.49
R3904:Mrm3 UTSW 11 76244286 missense probably benign 0.05
R5591:Mrm3 UTSW 11 76250081 missense probably benign
R7343:Mrm3 UTSW 11 76249900 missense probably damaging 1.00
R7346:Mrm3 UTSW 11 76250176 missense possibly damaging 0.51
Predicted Primers PCR Primer
(F):5'- TGCCCAAACTTGAGGTCCAG -3'
(R):5'- AAGGCACTGGGAATTTGGC -3'

Sequencing Primer
(F):5'- CCCAAACTTGAGGTCCAGAGTTATG -3'
(R):5'- GTTCCAGGGGATATGACACCTCTAC -3'
Posted On2020-01-23