Incidental Mutation 'R8010:Nek8'
ID616867
Institutional Source Beutler Lab
Gene Symbol Nek8
Ensembl Gene ENSMUSG00000017405
Gene NameNIMA (never in mitosis gene a)-related expressed kinase 8
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.888) question?
Stock #R8010 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location78166106-78176675 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 78176596 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 4 (Y4C)
Ref Sequence ENSEMBL: ENSMUSP00000017549 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017549] [ENSMUST00000092880] [ENSMUST00000098545] [ENSMUST00000102483] [ENSMUST00000108338] [ENSMUST00000127587] [ENSMUST00000147819] [ENSMUST00000148154]
Predicted Effect probably damaging
Transcript: ENSMUST00000017549
AA Change: Y4C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000017549
Gene: ENSMUSG00000017405
AA Change: Y4C

DomainStartEndE-ValueType
S_TKc 4 258 1.59e-81 SMART
low complexity region 288 316 N/A INTRINSIC
low complexity region 364 378 N/A INTRINSIC
Pfam:RCC1 415 464 4.1e-12 PFAM
Pfam:RCC1_2 451 480 9.2e-10 PFAM
Pfam:RCC1 467 516 9.9e-16 PFAM
Pfam:RCC1 585 634 4.4e-15 PFAM
Pfam:RCC1 637 687 2e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000092880
SMART Domains Protein: ENSMUSP00000090556
Gene: ENSMUSG00000019437

DomainStartEndE-ValueType
TLC 28 217 1.19e-36 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000098545
SMART Domains Protein: ENSMUSP00000096145
Gene: ENSMUSG00000019437

DomainStartEndE-ValueType
TLC 40 207 5.98e-33 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102483
SMART Domains Protein: ENSMUSP00000099541
Gene: ENSMUSG00000058546

DomainStartEndE-ValueType
Pfam:Ribosomal_L23eN 15 68 9.7e-26 PFAM
Pfam:Ribosomal_L23 74 153 1.8e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108338
SMART Domains Protein: ENSMUSP00000103975
Gene: ENSMUSG00000019437

DomainStartEndE-ValueType
Pfam:TRAM_LAG1_CLN8 44 122 3.3e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127587
SMART Domains Protein: ENSMUSP00000114202
Gene: ENSMUSG00000019437

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
TLC 40 234 1.41e-52 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000147819
SMART Domains Protein: ENSMUSP00000126593
Gene: ENSMUSG00000019437

DomainStartEndE-ValueType
Pfam:TRAM_LAG1_CLN8 33 103 4.1e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000148154
SMART Domains Protein: ENSMUSP00000127554
Gene: ENSMUSG00000017405

DomainStartEndE-ValueType
Pfam:Pkinase 1 103 4.1e-20 PFAM
Pfam:Pkinase_Tyr 1 103 3.2e-12 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a NIMA-related kinase. Members of this serine/threonine protein kinase family are structurally-related to NIMA (never in mitosis, gene A) which controls mitotic signaling in Aspergillus nidulans. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice display kidney cysts primarily in the cortex, progressive kidney enlargement, increased serum creatinine levels, impaired maternal nurturing, and premature death. Heterotaxy with congenital heart disease such as hypoplastic right ventricle and small tricuspid valve is seen. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 T A 6: 128,580,340 H130L probably benign Het
Abca1 A G 4: 53,127,600 S140P probably benign Het
AI314180 T A 4: 58,832,681 Q893L unknown Het
Aoc1 T C 6: 48,905,648 Y153H probably benign Het
Arhgdib A G 6: 136,926,722 I118T probably damaging Het
Atp1a3 T A 7: 24,980,645 E865V possibly damaging Het
Atrnl1 T C 19: 57,682,446 V587A probably benign Het
C130026I21Rik G A 1: 85,246,950 S288L possibly damaging Het
Ccdc107 G T 4: 43,495,768 E199* probably null Het
Cd55 A T 1: 130,459,616 D148E probably benign Het
Cdc42ep1 C T 15: 78,847,799 T148I possibly damaging Het
Cep164 A T 9: 45,823,671 D19E unknown Het
Chsy3 A G 18: 59,410,154 Y788C probably damaging Het
Cttnbp2 G C 6: 18,426,093 A762G possibly damaging Het
Cubn A G 2: 13,336,086 probably null Het
Ddr1 T A 17: 35,691,492 M175L possibly damaging Het
Dicer1 C A 12: 104,692,132 K1850N probably damaging Het
Dnajc6 C T 4: 101,618,414 R495C probably benign Het
Fbxo18 A T 2: 11,767,632 N79K probably benign Het
Frmpd1 T A 4: 45,284,272 V1031D possibly damaging Het
Gm7298 A G 6: 121,735,583 E118G probably benign Het
Hnrnpll T C 17: 80,061,956 T13A unknown Het
Jcad A G 18: 4,674,581 D781G probably benign Het
Kitl A T 10: 100,051,903 T25S probably benign Het
Krt5 T C 15: 101,712,356 D152G probably damaging Het
Krtap5-5 T C 7: 142,229,911 M1V probably null Het
Ktn1 C T 14: 47,705,773 T862I possibly damaging Het
Mapk4 A T 18: 73,930,576 I525N probably benign Het
Megf6 T C 4: 154,270,507 F1457S probably benign Het
Mrm3 A T 11: 76,250,347 S394C probably damaging Het
Mtmr4 T G 11: 87,598,864 V71G probably damaging Het
Olfr203 T C 16: 59,303,504 M117T probably damaging Het
Olfr309 T A 7: 86,307,052 E20D probably benign Het
Olfr849 A T 9: 19,441,692 I260L probably benign Het
Pla2r1 T C 2: 60,514,960 T351A probably benign Het
Plcb4 C T 2: 135,907,560 T49M probably benign Het
Psg20 T C 7: 18,681,067 D301G probably benign Het
Ptpn13 C T 5: 103,559,937 Q1455* probably null Het
Rbbp8 A T 18: 11,722,233 N505I possibly damaging Het
Rgs18 A G 1: 144,756,000 C125R probably benign Het
Rpap2 G A 5: 107,603,605 C105Y probably damaging Het
Scn10a C T 9: 119,661,167 G570R possibly damaging Het
Sell C T 1: 164,065,512 T99I possibly damaging Het
Slc14a1 A T 18: 78,116,489 M63K probably benign Het
Syne2 A T 12: 75,930,738 D1319V probably benign Het
Tdp2 C T 13: 24,836,027 T99I probably damaging Het
Tet3 A T 6: 83,403,246 S647T unknown Het
Tpd52l1 T G 10: 31,358,013 D48A possibly damaging Het
Ttll10 T C 4: 156,047,161 D169G probably damaging Het
Wars2 C A 3: 99,216,830 L336I probably benign Het
Wdfy4 C A 14: 32,971,627 W2906L Het
Xdh A T 17: 73,909,317 Y711* probably null Het
Xirp1 T A 9: 120,017,824 R664S probably benign Het
Other mutations in Nek8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00426:Nek8 APN 11 78167827 missense probably damaging 0.96
IGL00914:Nek8 APN 11 78173075 missense possibly damaging 0.80
nerkkod UTSW 11 78173059 missense probably damaging 1.00
R0136:Nek8 UTSW 11 78171207 missense probably benign 0.01
R0490:Nek8 UTSW 11 78167729 missense probably benign 0.01
R0657:Nek8 UTSW 11 78171207 missense probably benign 0.01
R1033:Nek8 UTSW 11 78171285 missense probably null 1.00
R2848:Nek8 UTSW 11 78168141 missense probably damaging 1.00
R3406:Nek8 UTSW 11 78170746 nonsense probably null
R4211:Nek8 UTSW 11 78170483 missense probably benign
R4810:Nek8 UTSW 11 78167803 missense probably benign 0.00
R4811:Nek8 UTSW 11 78167718 splice site probably null
R5108:Nek8 UTSW 11 78172527 missense probably damaging 0.96
R5124:Nek8 UTSW 11 78172939 missense probably damaging 1.00
R5177:Nek8 UTSW 11 78170471 nonsense probably null
R5212:Nek8 UTSW 11 78172516 start codon destroyed probably null 0.02
R5386:Nek8 UTSW 11 78170437 splice site probably null
R5921:Nek8 UTSW 11 78173059 missense probably damaging 1.00
R5977:Nek8 UTSW 11 78167825 missense probably benign 0.01
R8195:Nek8 UTSW 11 78170761 missense possibly damaging 0.77
X0026:Nek8 UTSW 11 78168105 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TAAACCTAAGGACCGGATGC -3'
(R):5'- CCCAGAACGACTATTCTCTGATCC -3'

Sequencing Primer
(F):5'- TAAGGACCGGATGCCTGGG -3'
(R):5'- ACACGACTTAGCCTCTAGGTTGAG -3'
Posted On2020-01-23