Incidental Mutation 'R8010:Krt5'
ID616875
Institutional Source Beutler Lab
Gene Symbol Krt5
Ensembl Gene ENSMUSG00000061527
Gene Namekeratin 5
SynonymsKrt2-5, Tfip8, 3300001P10Rik, K5
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8010 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location101707070-101712898 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 101712356 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 152 (D152G)
Ref Sequence ENSEMBL: ENSMUSP00000023709 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023709]
Predicted Effect probably damaging
Transcript: ENSMUST00000023709
AA Change: D152G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000023709
Gene: ENSMUSG00000061527
AA Change: D152G

DomainStartEndE-ValueType
Pfam:Keratin_2_head 16 158 3.6e-44 PFAM
Filament 161 474 1.58e-174 SMART
low complexity region 483 577 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the keratin gene family. The type II cytokeratins consist of basic or neutral proteins which are arranged in pairs of heterotypic keratin chains coexpressed during differentiation of simple and stratified epithelial tissues. This type II cytokeratin is specifically expressed in the basal layer of the epidermis with family member KRT14. Mutations in these genes have been associated with a complex of diseases termed epidermolysis bullosa simplex. The type II cytokeratins are clustered in a region of chromosome 12q12-q13. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene die within the first hour after birth. They have a loose, fragile epidermal layer and abnormal epithelium in parts of the digestive tract. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 T A 6: 128,580,340 H130L probably benign Het
Abca1 A G 4: 53,127,600 S140P probably benign Het
AI314180 T A 4: 58,832,681 Q893L unknown Het
Aoc1 T C 6: 48,905,648 Y153H probably benign Het
Arhgdib A G 6: 136,926,722 I118T probably damaging Het
Atp1a3 T A 7: 24,980,645 E865V possibly damaging Het
Atrnl1 T C 19: 57,682,446 V587A probably benign Het
C130026I21Rik G A 1: 85,246,950 S288L possibly damaging Het
Ccdc107 G T 4: 43,495,768 E199* probably null Het
Cd55 A T 1: 130,459,616 D148E probably benign Het
Cdc42ep1 C T 15: 78,847,799 T148I possibly damaging Het
Cep164 A T 9: 45,823,671 D19E unknown Het
Chsy3 A G 18: 59,410,154 Y788C probably damaging Het
Cttnbp2 G C 6: 18,426,093 A762G possibly damaging Het
Cubn A G 2: 13,336,086 probably null Het
Ddr1 T A 17: 35,691,492 M175L possibly damaging Het
Dicer1 C A 12: 104,692,132 K1850N probably damaging Het
Dnajc6 C T 4: 101,618,414 R495C probably benign Het
Fbxo18 A T 2: 11,767,632 N79K probably benign Het
Frmpd1 T A 4: 45,284,272 V1031D possibly damaging Het
Gm7298 A G 6: 121,735,583 E118G probably benign Het
Hnrnpll T C 17: 80,061,956 T13A unknown Het
Jcad A G 18: 4,674,581 D781G probably benign Het
Kitl A T 10: 100,051,903 T25S probably benign Het
Krtap5-5 T C 7: 142,229,911 M1V probably null Het
Ktn1 C T 14: 47,705,773 T862I possibly damaging Het
Mapk4 A T 18: 73,930,576 I525N probably benign Het
Megf6 T C 4: 154,270,507 F1457S probably benign Het
Mrm3 A T 11: 76,250,347 S394C probably damaging Het
Mtmr4 T G 11: 87,598,864 V71G probably damaging Het
Nek8 T C 11: 78,176,596 Y4C probably damaging Het
Olfr203 T C 16: 59,303,504 M117T probably damaging Het
Olfr309 T A 7: 86,307,052 E20D probably benign Het
Olfr849 A T 9: 19,441,692 I260L probably benign Het
Pla2r1 T C 2: 60,514,960 T351A probably benign Het
Plcb4 C T 2: 135,907,560 T49M probably benign Het
Psg20 T C 7: 18,681,067 D301G probably benign Het
Ptpn13 C T 5: 103,559,937 Q1455* probably null Het
Rbbp8 A T 18: 11,722,233 N505I possibly damaging Het
Rgs18 A G 1: 144,756,000 C125R probably benign Het
Rpap2 G A 5: 107,603,605 C105Y probably damaging Het
Scn10a C T 9: 119,661,167 G570R possibly damaging Het
Sell C T 1: 164,065,512 T99I possibly damaging Het
Slc14a1 A T 18: 78,116,489 M63K probably benign Het
Syne2 A T 12: 75,930,738 D1319V probably benign Het
Tdp2 C T 13: 24,836,027 T99I probably damaging Het
Tet3 A T 6: 83,403,246 S647T unknown Het
Tpd52l1 T G 10: 31,358,013 D48A possibly damaging Het
Ttll10 T C 4: 156,047,161 D169G probably damaging Het
Wars2 C A 3: 99,216,830 L336I probably benign Het
Wdfy4 C A 14: 32,971,627 W2906L Het
Xdh A T 17: 73,909,317 Y711* probably null Het
Xirp1 T A 9: 120,017,824 R664S probably benign Het
Other mutations in Krt5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00475:Krt5 APN 15 101712641 missense unknown
IGL01949:Krt5 APN 15 101710613 missense probably benign 0.14
IGL03013:Krt5 APN 15 101711668 missense probably benign 0.00
IGL03286:Krt5 APN 15 101707548 missense unknown
R1598:Krt5 UTSW 15 101712441 missense probably benign 0.38
R1697:Krt5 UTSW 15 101710585 missense probably benign 0.06
R1967:Krt5 UTSW 15 101711659 missense probably benign 0.21
R2143:Krt5 UTSW 15 101712359 missense probably damaging 1.00
R2438:Krt5 UTSW 15 101711658 missense probably benign 0.10
R4633:Krt5 UTSW 15 101711607 missense probably damaging 0.98
R4771:Krt5 UTSW 15 101709059 missense probably damaging 0.99
R4918:Krt5 UTSW 15 101710307 missense probably damaging 1.00
R5622:Krt5 UTSW 15 101709035 missense probably damaging 1.00
R6797:Krt5 UTSW 15 101712641 missense unknown
R6873:Krt5 UTSW 15 101712877 start gained probably benign
R7808:Krt5 UTSW 15 101709018 missense probably benign 0.01
R8252:Krt5 UTSW 15 101712359 missense probably damaging 1.00
X0019:Krt5 UTSW 15 101712368 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- ACACAGGCAGTATCAGAGCTG -3'
(R):5'- GCAGCTTCAGGAACCAATTTG -3'

Sequencing Primer
(F):5'- AGAGCTGAGACTGAAGCCTCTTC -3'
(R):5'- GCTTTGGAGGAGGAGCCG -3'
Posted On2020-01-23