Incidental Mutation 'R8010:Ddr1'
ID616877
Institutional Source Beutler Lab
Gene Symbol Ddr1
Ensembl Gene ENSMUSG00000003534
Gene Namediscoidin domain receptor family, member 1
SynonymsCak, CD167a
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.928) question?
Stock #R8010 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location35681567-35704621 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 35691492 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 175 (M175L)
Ref Sequence ENSEMBL: ENSMUSP00000003628 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003628] [ENSMUST00000097333] [ENSMUST00000117301] [ENSMUST00000119825] [ENSMUST00000134995] [ENSMUST00000135078] [ENSMUST00000145900] [ENSMUST00000146472] [ENSMUST00000148065] [ENSMUST00000155628] [ENSMUST00000155957] [ENSMUST00000166980]
Predicted Effect possibly damaging
Transcript: ENSMUST00000003628
AA Change: M175L

PolyPhen 2 Score 0.932 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000003628
Gene: ENSMUSG00000003534
AA Change: M175L

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
FA58C 31 186 1.3e-36 SMART
low complexity region 218 236 N/A INTRINSIC
low complexity region 379 390 N/A INTRINSIC
transmembrane domain 415 437 N/A INTRINSIC
low complexity region 473 492 N/A INTRINSIC
low complexity region 520 530 N/A INTRINSIC
low complexity region 548 565 N/A INTRINSIC
TyrKc 608 903 3.9e-131 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000097333
AA Change: M175L

PolyPhen 2 Score 0.776 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000094945
Gene: ENSMUSG00000003534
AA Change: M175L

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
FA58C 31 186 2.75e-34 SMART
low complexity region 218 236 N/A INTRINSIC
low complexity region 379 390 N/A INTRINSIC
transmembrane domain 415 437 N/A INTRINSIC
low complexity region 473 492 N/A INTRINSIC
low complexity region 511 528 N/A INTRINSIC
TyrKc 571 866 8.14e-129 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000117301
AA Change: M175L

PolyPhen 2 Score 0.932 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000112570
Gene: ENSMUSG00000003534
AA Change: M175L

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
FA58C 31 186 1.3e-36 SMART
low complexity region 218 236 N/A INTRINSIC
low complexity region 379 390 N/A INTRINSIC
transmembrane domain 415 437 N/A INTRINSIC
low complexity region 473 492 N/A INTRINSIC
low complexity region 520 530 N/A INTRINSIC
low complexity region 548 565 N/A INTRINSIC
TyrKc 608 903 4e-131 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000119825
AA Change: M175L

PolyPhen 2 Score 0.932 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000113062
Gene: ENSMUSG00000003534
AA Change: M175L

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
FA58C 31 186 1.3e-36 SMART
low complexity region 218 236 N/A INTRINSIC
low complexity region 379 390 N/A INTRINSIC
transmembrane domain 415 437 N/A INTRINSIC
low complexity region 473 492 N/A INTRINSIC
low complexity region 520 530 N/A INTRINSIC
low complexity region 548 565 N/A INTRINSIC
TyrKc 608 903 3.9e-131 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000134995
AA Change: M175L

PolyPhen 2 Score 0.932 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000117301
Gene: ENSMUSG00000003534
AA Change: M175L

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
FA58C 31 186 2.75e-34 SMART
low complexity region 218 236 N/A INTRINSIC
Blast:FA58C 239 264 2e-7 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000135078
SMART Domains Protein: ENSMUSP00000122191
Gene: ENSMUSG00000003534

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
PDB:4AG4|A 30 89 5e-22 PDB
Blast:FA58C 31 89 6e-25 BLAST
SCOP:d1d7pm_ 32 78 5e-11 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000145900
AA Change: M175L

PolyPhen 2 Score 0.932 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000122361
Gene: ENSMUSG00000003534
AA Change: M175L

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
FA58C 31 186 2.75e-34 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000146472
AA Change: M175L

PolyPhen 2 Score 0.932 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000119397
Gene: ENSMUSG00000003534
AA Change: M175L

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
FA58C 31 186 2.75e-34 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000148065
AA Change: M45L

PolyPhen 2 Score 0.932 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000120635
Gene: ENSMUSG00000003534
AA Change: M45L

DomainStartEndE-ValueType
Blast:FA58C 1 56 2e-33 BLAST
SCOP:d1d7pm_ 1 58 2e-11 SMART
PDB:4AG4|A 1 143 3e-73 PDB
Blast:FA58C 109 143 1e-13 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000155628
AA Change: M175L

PolyPhen 2 Score 0.776 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000133659
Gene: ENSMUSG00000003534
AA Change: M175L

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
FA58C 31 186 2.75e-34 SMART
low complexity region 218 236 N/A INTRINSIC
Blast:FA58C 239 319 1e-45 BLAST
low complexity region 379 390 N/A INTRINSIC
transmembrane domain 415 437 N/A INTRINSIC
low complexity region 473 492 N/A INTRINSIC
low complexity region 511 528 N/A INTRINSIC
PDB:4CKR|A 562 584 3e-6 PDB
Predicted Effect possibly damaging
Transcript: ENSMUST00000155957
AA Change: M175L

PolyPhen 2 Score 0.751 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000117427
Gene: ENSMUSG00000003534
AA Change: M175L

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
FA58C 31 186 2.75e-34 SMART
low complexity region 192 209 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000166980
AA Change: M175L

PolyPhen 2 Score 0.932 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000133047
Gene: ENSMUSG00000003534
AA Change: M175L

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
FA58C 31 186 1.3e-36 SMART
low complexity region 218 236 N/A INTRINSIC
low complexity region 379 390 N/A INTRINSIC
transmembrane domain 415 437 N/A INTRINSIC
low complexity region 473 492 N/A INTRINSIC
low complexity region 520 530 N/A INTRINSIC
low complexity region 548 565 N/A INTRINSIC
TyrKc 608 903 3.9e-131 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Receptor tyrosine kinases play a key role in the communication of cells with their microenvironment. These kinases are involved in the regulation of cell growth, differentiation and metabolism. The protein encoded by this gene belongs to a subfamily of tyrosine kinase receptors with homology to Dictyostelium discoideum protein discoidin I in their extracellular domain, and that are activated by various types of collagen. Expression of this protein is restricted to epithelial cells, particularly in the kidney, lung, gastrointestinal tract, and brain. In addition, it has been shown to be significantly overexpressed in several human tumors. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Feb 2011]
PHENOTYPE: Homozygous mutant mice are viable but smaller than control mice. Most mutant females are not able to give birth because developing blastocysts fail to implant. Successfully reproducing females show a lactation defect which is attributed to hyperproliferation and aberrant branching of mammary ducts. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 T A 6: 128,580,340 H130L probably benign Het
Abca1 A G 4: 53,127,600 S140P probably benign Het
AI314180 T A 4: 58,832,681 Q893L unknown Het
Aoc1 T C 6: 48,905,648 Y153H probably benign Het
Arhgdib A G 6: 136,926,722 I118T probably damaging Het
Atp1a3 T A 7: 24,980,645 E865V possibly damaging Het
Atrnl1 T C 19: 57,682,446 V587A probably benign Het
C130026I21Rik G A 1: 85,246,950 S288L possibly damaging Het
Ccdc107 G T 4: 43,495,768 E199* probably null Het
Cd55 A T 1: 130,459,616 D148E probably benign Het
Cdc42ep1 C T 15: 78,847,799 T148I possibly damaging Het
Cep164 A T 9: 45,823,671 D19E unknown Het
Chsy3 A G 18: 59,410,154 Y788C probably damaging Het
Cttnbp2 G C 6: 18,426,093 A762G possibly damaging Het
Cubn A G 2: 13,336,086 probably null Het
Dicer1 C A 12: 104,692,132 K1850N probably damaging Het
Dnajc6 C T 4: 101,618,414 R495C probably benign Het
Fbxo18 A T 2: 11,767,632 N79K probably benign Het
Frmpd1 T A 4: 45,284,272 V1031D possibly damaging Het
Gm7298 A G 6: 121,735,583 E118G probably benign Het
Hnrnpll T C 17: 80,061,956 T13A unknown Het
Jcad A G 18: 4,674,581 D781G probably benign Het
Kitl A T 10: 100,051,903 T25S probably benign Het
Krt5 T C 15: 101,712,356 D152G probably damaging Het
Krtap5-5 T C 7: 142,229,911 M1V probably null Het
Ktn1 C T 14: 47,705,773 T862I possibly damaging Het
Mapk4 A T 18: 73,930,576 I525N probably benign Het
Megf6 T C 4: 154,270,507 F1457S probably benign Het
Mrm3 A T 11: 76,250,347 S394C probably damaging Het
Mtmr4 T G 11: 87,598,864 V71G probably damaging Het
Nek8 T C 11: 78,176,596 Y4C probably damaging Het
Olfr203 T C 16: 59,303,504 M117T probably damaging Het
Olfr309 T A 7: 86,307,052 E20D probably benign Het
Olfr849 A T 9: 19,441,692 I260L probably benign Het
Pla2r1 T C 2: 60,514,960 T351A probably benign Het
Plcb4 C T 2: 135,907,560 T49M probably benign Het
Psg20 T C 7: 18,681,067 D301G probably benign Het
Ptpn13 C T 5: 103,559,937 Q1455* probably null Het
Rbbp8 A T 18: 11,722,233 N505I possibly damaging Het
Rgs18 A G 1: 144,756,000 C125R probably benign Het
Rpap2 G A 5: 107,603,605 C105Y probably damaging Het
Scn10a C T 9: 119,661,167 G570R possibly damaging Het
Sell C T 1: 164,065,512 T99I possibly damaging Het
Slc14a1 A T 18: 78,116,489 M63K probably benign Het
Syne2 A T 12: 75,930,738 D1319V probably benign Het
Tdp2 C T 13: 24,836,027 T99I probably damaging Het
Tet3 A T 6: 83,403,246 S647T unknown Het
Tpd52l1 T G 10: 31,358,013 D48A possibly damaging Het
Ttll10 T C 4: 156,047,161 D169G probably damaging Het
Wars2 C A 3: 99,216,830 L336I probably benign Het
Wdfy4 C A 14: 32,971,627 W2906L Het
Xdh A T 17: 73,909,317 Y711* probably null Het
Xirp1 T A 9: 120,017,824 R664S probably benign Het
Other mutations in Ddr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02021:Ddr1 APN 17 35683480 missense probably damaging 1.00
IGL02126:Ddr1 APN 17 35688589 missense probably damaging 0.99
IGL02167:Ddr1 APN 17 35690071 missense possibly damaging 0.55
IGL02250:Ddr1 APN 17 35683480 missense probably damaging 1.00
IGL02251:Ddr1 APN 17 35683480 missense probably damaging 1.00
IGL02367:Ddr1 APN 17 35683480 missense probably damaging 1.00
PIT4449001:Ddr1 UTSW 17 35687249 missense possibly damaging 0.54
R0538:Ddr1 UTSW 17 35685007 missense probably damaging 1.00
R0674:Ddr1 UTSW 17 35689669 nonsense probably null
R4829:Ddr1 UTSW 17 35685113 missense probably damaging 1.00
R4940:Ddr1 UTSW 17 35690130 missense probably damaging 1.00
R5085:Ddr1 UTSW 17 35682775 critical splice acceptor site probably null
R5112:Ddr1 UTSW 17 35682485 missense probably benign
R5124:Ddr1 UTSW 17 35683597 missense probably damaging 1.00
R5652:Ddr1 UTSW 17 35686508 missense probably benign
R5653:Ddr1 UTSW 17 35686508 missense probably benign
R5654:Ddr1 UTSW 17 35686508 missense probably benign
R6427:Ddr1 UTSW 17 35687222 missense probably benign
R7226:Ddr1 UTSW 17 35691147 missense possibly damaging 0.94
R7405:Ddr1 UTSW 17 35690100 missense probably damaging 1.00
R7534:Ddr1 UTSW 17 35682622 critical splice donor site probably null
R7568:Ddr1 UTSW 17 35684282 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTAGTGTGGAGAAGGCTATGC -3'
(R):5'- TGACCCCAATAGGTTGAGCC -3'

Sequencing Primer
(F):5'- AAGGCTATGCAGTTTAGTGCCCTC -3'
(R):5'- TTGAGCCAGGGAGCAGCTG -3'
Posted On2020-01-23