Incidental Mutation 'R8010:Rbbp8'
ID616881
Institutional Source Beutler Lab
Gene Symbol Rbbp8
Ensembl Gene ENSMUSG00000041238
Gene Nameretinoblastoma binding protein 8, endonuclease
Synonyms9930104E21Rik, CtIP
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8010 (G1)
Quality Score225.009
Status Not validated
Chromosome18
Chromosomal Location11633276-11743207 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 11722233 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 505 (N505I)
Ref Sequence ENSEMBL: ENSMUSP00000046255 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047322] [ENSMUST00000115861]
Predicted Effect possibly damaging
Transcript: ENSMUST00000047322
AA Change: N505I

PolyPhen 2 Score 0.669 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000046255
Gene: ENSMUSG00000041238
AA Change: N505I

DomainStartEndE-ValueType
Pfam:CtIP_N 20 139 9.6e-61 PFAM
PDB:2L4Z|A 639 675 3e-15 PDB
Pfam:SAE2 790 854 8.7e-13 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000115861
AA Change: N505I

PolyPhen 2 Score 0.669 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000111527
Gene: ENSMUSG00000041238
AA Change: N505I

DomainStartEndE-ValueType
Pfam:CtIP_N 20 139 5.2e-55 PFAM
PDB:2L4Z|A 639 675 3e-15 PDB
Pfam:SAE2 817 854 1.4e-8 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a ubiquitously expressed nuclear protein. It is found among several proteins that bind directly to retinoblastoma protein, which regulates cell proliferation. This protein complexes with transcriptional co-repressor CTBP. It is also associated with BRCA1 and is thought to modulate the functions of BRCA1 in transcriptional regulation, DNA repair, and/or cell cycle checkpoint control. It is suggested that this gene may itself be a tumor suppressor acting in the same pathway as BRCA1. Three transcript variants encoding two different isoforms have been found for this gene. More transcript variants exist, but their full-length natures have not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Embryos homozygous for a knock-out allele die at E4.0 as blastocysts fail to enter S phase and arrest at G1, leading to elevated cell death. Heterozygous mutant mice display a shortened lifespan due to formation of multiple tumors, mostly large lymphomasof both B and T cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 T A 6: 128,580,340 H130L probably benign Het
Abca1 A G 4: 53,127,600 S140P probably benign Het
AI314180 T A 4: 58,832,681 Q893L unknown Het
Aoc1 T C 6: 48,905,648 Y153H probably benign Het
Arhgdib A G 6: 136,926,722 I118T probably damaging Het
Atp1a3 T A 7: 24,980,645 E865V possibly damaging Het
Atrnl1 T C 19: 57,682,446 V587A probably benign Het
C130026I21Rik G A 1: 85,246,950 S288L possibly damaging Het
Ccdc107 G T 4: 43,495,768 E199* probably null Het
Cd55 A T 1: 130,459,616 D148E probably benign Het
Cdc42ep1 C T 15: 78,847,799 T148I possibly damaging Het
Cep164 A T 9: 45,823,671 D19E unknown Het
Chsy3 A G 18: 59,410,154 Y788C probably damaging Het
Cttnbp2 G C 6: 18,426,093 A762G possibly damaging Het
Cubn A G 2: 13,336,086 probably null Het
Ddr1 T A 17: 35,691,492 M175L possibly damaging Het
Dicer1 C A 12: 104,692,132 K1850N probably damaging Het
Dnajc6 C T 4: 101,618,414 R495C probably benign Het
Fbxo18 A T 2: 11,767,632 N79K probably benign Het
Frmpd1 T A 4: 45,284,272 V1031D possibly damaging Het
Gm7298 A G 6: 121,735,583 E118G probably benign Het
Hnrnpll T C 17: 80,061,956 T13A unknown Het
Jcad A G 18: 4,674,581 D781G probably benign Het
Kitl A T 10: 100,051,903 T25S probably benign Het
Krt5 T C 15: 101,712,356 D152G probably damaging Het
Krtap5-5 T C 7: 142,229,911 M1V probably null Het
Ktn1 C T 14: 47,705,773 T862I possibly damaging Het
Mapk4 A T 18: 73,930,576 I525N probably benign Het
Megf6 T C 4: 154,270,507 F1457S probably benign Het
Mrm3 A T 11: 76,250,347 S394C probably damaging Het
Mtmr4 T G 11: 87,598,864 V71G probably damaging Het
Nek8 T C 11: 78,176,596 Y4C probably damaging Het
Olfr203 T C 16: 59,303,504 M117T probably damaging Het
Olfr309 T A 7: 86,307,052 E20D probably benign Het
Olfr849 A T 9: 19,441,692 I260L probably benign Het
Pla2r1 T C 2: 60,514,960 T351A probably benign Het
Plcb4 C T 2: 135,907,560 T49M probably benign Het
Psg20 T C 7: 18,681,067 D301G probably benign Het
Ptpn13 C T 5: 103,559,937 Q1455* probably null Het
Rgs18 A G 1: 144,756,000 C125R probably benign Het
Rpap2 G A 5: 107,603,605 C105Y probably damaging Het
Scn10a C T 9: 119,661,167 G570R possibly damaging Het
Sell C T 1: 164,065,512 T99I possibly damaging Het
Slc14a1 A T 18: 78,116,489 M63K probably benign Het
Syne2 A T 12: 75,930,738 D1319V probably benign Het
Tdp2 C T 13: 24,836,027 T99I probably damaging Het
Tet3 A T 6: 83,403,246 S647T unknown Het
Tpd52l1 T G 10: 31,358,013 D48A possibly damaging Het
Ttll10 T C 4: 156,047,161 D169G probably damaging Het
Wars2 C A 3: 99,216,830 L336I probably benign Het
Wdfy4 C A 14: 32,971,627 W2906L Het
Xdh A T 17: 73,909,317 Y711* probably null Het
Xirp1 T A 9: 120,017,824 R664S probably benign Het
Other mutations in Rbbp8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00825:Rbbp8 APN 18 11722607 missense probably benign
IGL01302:Rbbp8 APN 18 11721979 missense probably benign
IGL01965:Rbbp8 APN 18 11722260 missense probably benign 0.04
IGL02076:Rbbp8 APN 18 11705819 missense probably damaging 1.00
IGL02410:Rbbp8 APN 18 11732212 missense probably damaging 1.00
IGL02823:Rbbp8 APN 18 11732213 missense possibly damaging 0.89
IGL02859:Rbbp8 APN 18 11738614 missense probably benign 0.42
IGL02966:Rbbp8 APN 18 11705812 missense possibly damaging 0.88
IGL03022:Rbbp8 APN 18 11725502 splice site probably benign
IGL03274:Rbbp8 APN 18 11741076 splice site probably benign
IGL03367:Rbbp8 APN 18 11721719 missense probably benign 0.08
R0063:Rbbp8 UTSW 18 11734557 splice site probably benign
R0063:Rbbp8 UTSW 18 11734557 splice site probably benign
R0167:Rbbp8 UTSW 18 11660922 nonsense probably null
R0314:Rbbp8 UTSW 18 11715818 missense probably benign 0.17
R0864:Rbbp8 UTSW 18 11732184 splice site probably benign
R1033:Rbbp8 UTSW 18 11742705 missense probably benign 0.41
R1678:Rbbp8 UTSW 18 11732315 missense probably benign 0.05
R1964:Rbbp8 UTSW 18 11742679 missense possibly damaging 0.62
R2002:Rbbp8 UTSW 18 11727166 splice site probably benign
R2015:Rbbp8 UTSW 18 11720624 missense probably benign 0.01
R2240:Rbbp8 UTSW 18 11677669 missense probably damaging 0.99
R2308:Rbbp8 UTSW 18 11696776 missense possibly damaging 0.95
R3946:Rbbp8 UTSW 18 11718868 missense probably benign
R4375:Rbbp8 UTSW 18 11725410 missense probably benign 0.00
R4590:Rbbp8 UTSW 18 11732265 nonsense probably null
R4695:Rbbp8 UTSW 18 11721782 nonsense probably null
R4769:Rbbp8 UTSW 18 11722670 missense probably damaging 1.00
R5161:Rbbp8 UTSW 18 11722114 missense probably damaging 1.00
R5195:Rbbp8 UTSW 18 11722151 missense probably benign 0.00
R5223:Rbbp8 UTSW 18 11721690 missense probably benign 0.19
R5573:Rbbp8 UTSW 18 11722607 missense probably benign
R5671:Rbbp8 UTSW 18 11742642 missense probably benign 0.00
R6051:Rbbp8 UTSW 18 11738607 missense probably benign 0.17
R6995:Rbbp8 UTSW 18 11718908 missense probably damaging 1.00
R7048:Rbbp8 UTSW 18 11732220 missense possibly damaging 0.92
R7261:Rbbp8 UTSW 18 11705742 missense probably damaging 0.99
R7305:Rbbp8 UTSW 18 11672581 critical splice acceptor site probably null
R7319:Rbbp8 UTSW 18 11732212 missense probably damaging 1.00
R7447:Rbbp8 UTSW 18 11660877 missense probably benign 0.00
R7949:Rbbp8 UTSW 18 11718835 missense probably benign 0.00
R8116:Rbbp8 UTSW 18 11722670 missense probably damaging 1.00
R8292:Rbbp8 UTSW 18 11705712 missense probably benign
R8314:Rbbp8 UTSW 18 11720625 missense probably benign 0.06
Z1176:Rbbp8 UTSW 18 11732262 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GTGCCTTTGAAATCCCTGGG -3'
(R):5'- TCTGGAGAGAATTTACTAGAGGACTG -3'

Sequencing Primer
(F):5'- ATCCCTGGGAGGCAAAGCATC -3'
(R):5'- ATTTACTAGAGGACTGGAGGCTCCTC -3'
Posted On2020-01-23