Incidental Mutation 'R8010:Slc14a1'
ID616884
Institutional Source Beutler Lab
Gene Symbol Slc14a1
Ensembl Gene ENSMUSG00000059336
Gene Namesolute carrier family 14 (urea transporter), member 1
SynonymsUT-B, 2610507K20Rik, 3021401A05Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8010 (G1)
Quality Score225.009
Status Not validated
Chromosome18
Chromosomal Location78100091-78142119 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 78116489 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 63 (M63K)
Ref Sequence ENSEMBL: ENSMUSP00000125114 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091813] [ENSMUST00000160292] [ENSMUST00000160639]
Predicted Effect probably benign
Transcript: ENSMUST00000091813
AA Change: M7K

PolyPhen 2 Score 0.060 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000089421
Gene: ENSMUSG00000059336
AA Change: M7K

DomainStartEndE-ValueType
Pfam:UT 52 356 1.6e-120 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000160292
AA Change: M63K

PolyPhen 2 Score 0.094 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000125114
Gene: ENSMUSG00000059336
AA Change: M63K

DomainStartEndE-ValueType
Pfam:UT 110 405 6.3e-112 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000160639
AA Change: M7K

PolyPhen 2 Score 0.060 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000125367
Gene: ENSMUSG00000059336
AA Change: M7K

DomainStartEndE-ValueType
Pfam:UT 52 356 1.6e-120 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a membrane transporter that mediates urea transport in erythrocytes. This gene forms the basis for the Kidd blood group system. [provided by RefSeq, Mar 2009]
PHENOTYPE: Mice homozygous for disruptions in this gene display a grossly normal phenotype although they have an inability to concentrate urea in urine. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 T A 6: 128,580,340 H130L probably benign Het
Abca1 A G 4: 53,127,600 S140P probably benign Het
AI314180 T A 4: 58,832,681 Q893L unknown Het
Aoc1 T C 6: 48,905,648 Y153H probably benign Het
Arhgdib A G 6: 136,926,722 I118T probably damaging Het
Atp1a3 T A 7: 24,980,645 E865V possibly damaging Het
Atrnl1 T C 19: 57,682,446 V587A probably benign Het
C130026I21Rik G A 1: 85,246,950 S288L possibly damaging Het
Ccdc107 G T 4: 43,495,768 E199* probably null Het
Cd55 A T 1: 130,459,616 D148E probably benign Het
Cdc42ep1 C T 15: 78,847,799 T148I possibly damaging Het
Cep164 A T 9: 45,823,671 D19E unknown Het
Chsy3 A G 18: 59,410,154 Y788C probably damaging Het
Cttnbp2 G C 6: 18,426,093 A762G possibly damaging Het
Cubn A G 2: 13,336,086 probably null Het
Ddr1 T A 17: 35,691,492 M175L possibly damaging Het
Dicer1 C A 12: 104,692,132 K1850N probably damaging Het
Dnajc6 C T 4: 101,618,414 R495C probably benign Het
Fbxo18 A T 2: 11,767,632 N79K probably benign Het
Frmpd1 T A 4: 45,284,272 V1031D possibly damaging Het
Gm7298 A G 6: 121,735,583 E118G probably benign Het
Hnrnpll T C 17: 80,061,956 T13A unknown Het
Jcad A G 18: 4,674,581 D781G probably benign Het
Kitl A T 10: 100,051,903 T25S probably benign Het
Krt5 T C 15: 101,712,356 D152G probably damaging Het
Krtap5-5 T C 7: 142,229,911 M1V probably null Het
Ktn1 C T 14: 47,705,773 T862I possibly damaging Het
Mapk4 A T 18: 73,930,576 I525N probably benign Het
Megf6 T C 4: 154,270,507 F1457S probably benign Het
Mrm3 A T 11: 76,250,347 S394C probably damaging Het
Mtmr4 T G 11: 87,598,864 V71G probably damaging Het
Nek8 T C 11: 78,176,596 Y4C probably damaging Het
Olfr203 T C 16: 59,303,504 M117T probably damaging Het
Olfr309 T A 7: 86,307,052 E20D probably benign Het
Olfr849 A T 9: 19,441,692 I260L probably benign Het
Pla2r1 T C 2: 60,514,960 T351A probably benign Het
Plcb4 C T 2: 135,907,560 T49M probably benign Het
Psg20 T C 7: 18,681,067 D301G probably benign Het
Ptpn13 C T 5: 103,559,937 Q1455* probably null Het
Rbbp8 A T 18: 11,722,233 N505I possibly damaging Het
Rgs18 A G 1: 144,756,000 C125R probably benign Het
Rpap2 G A 5: 107,603,605 C105Y probably damaging Het
Scn10a C T 9: 119,661,167 G570R possibly damaging Het
Sell C T 1: 164,065,512 T99I possibly damaging Het
Syne2 A T 12: 75,930,738 D1319V probably benign Het
Tdp2 C T 13: 24,836,027 T99I probably damaging Het
Tet3 A T 6: 83,403,246 S647T unknown Het
Tpd52l1 T G 10: 31,358,013 D48A possibly damaging Het
Ttll10 T C 4: 156,047,161 D169G probably damaging Het
Wars2 C A 3: 99,216,830 L336I probably benign Het
Wdfy4 C A 14: 32,971,627 W2906L Het
Xdh A T 17: 73,909,317 Y711* probably null Het
Xirp1 T A 9: 120,017,824 R664S probably benign Het
Other mutations in Slc14a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00538:Slc14a1 APN 18 78104073 missense probably damaging 1.00
Glen_eyrie UTSW 18 78110058 critical splice acceptor site probably null
R1726:Slc14a1 UTSW 18 78116466 missense probably benign 0.21
R1889:Slc14a1 UTSW 18 78109697 missense possibly damaging 0.95
R1895:Slc14a1 UTSW 18 78109697 missense possibly damaging 0.95
R3946:Slc14a1 UTSW 18 78111392 missense probably benign 0.00
R4066:Slc14a1 UTSW 18 78111377 missense probably damaging 0.99
R5511:Slc14a1 UTSW 18 78102471 missense probably benign 0.01
R5763:Slc14a1 UTSW 18 78116414 missense probably benign 0.33
R6228:Slc14a1 UTSW 18 78116399 missense probably damaging 1.00
R6294:Slc14a1 UTSW 18 78110058 critical splice acceptor site probably null
R7157:Slc14a1 UTSW 18 78102411 missense probably benign 0.00
R7486:Slc14a1 UTSW 18 78111524 missense probably benign 0.00
R7657:Slc14a1 UTSW 18 78113664 critical splice donor site probably null
R8028:Slc14a1 UTSW 18 78116512 missense probably benign 0.00
R8322:Slc14a1 UTSW 18 78102441 missense possibly damaging 0.73
R8347:Slc14a1 UTSW 18 78111431 missense probably benign
Z1177:Slc14a1 UTSW 18 78104060 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGCACAGGCAAAGGATGTCC -3'
(R):5'- TTCTCAGAGCCATGACACTG -3'

Sequencing Primer
(F):5'- AGGATGTCCTCGGCTGCTTC -3'
(R):5'- GGGCATCTGGGTTACAACTCATAAC -3'
Posted On2020-01-23