Incidental Mutation 'R8011:Serpinb7'
ID616887
Institutional Source Beutler Lab
Gene Symbol Serpinb7
Ensembl Gene ENSMUSG00000067001
Gene Nameserine (or cysteine) peptidase inhibitor, clade B, member 7
Synonymsmegsin, 4631416M05Rik, ovalbumin
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R8011 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location107399655-107452689 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 107434757 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 64 (S64T)
Ref Sequence ENSEMBL: ENSMUSP00000083896 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086690] [ENSMUST00000154538]
Predicted Effect possibly damaging
Transcript: ENSMUST00000086690
AA Change: S64T

PolyPhen 2 Score 0.872 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000083896
Gene: ENSMUSG00000067001
AA Change: S64T

DomainStartEndE-ValueType
SERPIN 13 380 2.7e-121 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000154538
AA Change: S64T

PolyPhen 2 Score 0.872 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000119217
Gene: ENSMUSG00000067001
AA Change: S64T

DomainStartEndE-ValueType
Pfam:Serpin 6 97 4.9e-20 PFAM
Meta Mutation Damage Score 0.1116 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 100% (46/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of proteins which function as protease inhibitors. Expression of this gene is upregulated in IgA nephropathy and mutations have been found to cause palmoplantar keratoderma, Nagashima type. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2014]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik C T 9: 124,293,899 E132K Het
Acss2 T C 2: 155,555,957 I313T possibly damaging Het
Akap13 G A 7: 75,730,465 R462H probably damaging Het
Ankrd27 T C 7: 35,616,881 V524A probably benign Het
Cacna1e T C 1: 154,465,822 I1209V probably benign Het
Cntn3 A T 6: 102,437,899 I29N possibly damaging Het
Col5a1 G A 2: 27,980,521 probably benign Het
Cttnbp2 G C 6: 18,426,093 A762G possibly damaging Het
Edc3 C A 9: 57,713,376 probably benign Het
Egflam A T 15: 7,247,044 M547K possibly damaging Het
Fgr T C 4: 132,998,479 Y400H probably damaging Het
Gaa C T 11: 119,272,936 P205S probably benign Het
Gm14139 A G 2: 150,192,346 S196G possibly damaging Het
Gpr6 T A 10: 41,070,915 T224S probably benign Het
Hes3 T C 4: 152,287,481 probably benign Het
Hydin T C 8: 110,583,909 F4079S probably damaging Het
Igf2bp2 A T 16: 22,076,099 I366N probably damaging Het
Kmt2c A G 5: 25,351,234 V1171A probably damaging Het
Kndc1 T A 7: 139,910,620 F346Y possibly damaging Het
Lpin2 G A 17: 71,230,375 G306R probably benign Het
Mok T C 12: 110,814,917 probably benign Het
Nolc1 T C 19: 46,081,584 V265A unknown Het
Ogfr GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG 2: 180,595,266 probably benign Het
Olfr1018 T G 2: 85,823,613 L214R possibly damaging Het
Olfr1106 A C 2: 87,048,846 L130R probably damaging Het
Olfr1195 G A 2: 88,683,193 Q180* probably null Het
Olfr1415 A G 1: 92,491,275 V160A possibly damaging Het
Parp14 G A 16: 35,856,634 T988I probably benign Het
Pdk1 A T 2: 71,875,452 Q81H probably benign Het
Plekha6 A G 1: 133,263,806 T38A probably benign Het
Pou2f1 A G 1: 165,894,903 probably null Het
Rgs6 A G 12: 83,116,292 D424G probably null Het
Rnf13 T G 3: 57,807,070 Y183* probably null Het
Ryr2 A T 13: 11,588,140 probably null Het
Six2 T C 17: 85,687,672 E94G probably damaging Het
Slc44a5 A G 3: 154,247,810 I276M possibly damaging Het
Smco2 A G 6: 146,868,135 Y239C probably damaging Het
Ssx2ip T C 3: 146,422,911 S148P probably damaging Het
Tiam2 T C 17: 3,448,396 Y816H possibly damaging Het
Tnk2 C T 16: 32,668,365 R127C probably benign Het
Tpd52l1 T C 10: 31,332,917 N185S probably benign Het
Try5 T C 6: 41,313,487 D21G probably benign Het
Vmn2r20 A G 6: 123,396,410 V491A possibly damaging Het
Vps54 G T 11: 21,275,095 R197L probably damaging Het
Xkr5 G T 8: 18,948,720 Y27* probably null Het
Zfp626 T A 7: 27,818,715 C374S possibly damaging Het
Other mutations in Serpinb7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00971:Serpinb7 APN 1 107428246 utr 5 prime probably benign
IGL01325:Serpinb7 APN 1 107435380 missense probably damaging 0.98
IGL01595:Serpinb7 APN 1 107428322 missense probably damaging 0.97
IGL01925:Serpinb7 APN 1 107451669 missense probably benign 0.01
IGL02008:Serpinb7 APN 1 107448129 missense possibly damaging 0.51
IGL02206:Serpinb7 APN 1 107435372 missense possibly damaging 0.88
IGL02870:Serpinb7 APN 1 107450287 missense probably damaging 1.00
IGL03010:Serpinb7 APN 1 107452011 utr 3 prime probably benign
R0455:Serpinb7 UTSW 1 107451610 missense possibly damaging 0.91
R0492:Serpinb7 UTSW 1 107452007 makesense probably null
R0664:Serpinb7 UTSW 1 107428307 missense probably damaging 0.98
R1495:Serpinb7 UTSW 1 107451660 nonsense probably null
R1540:Serpinb7 UTSW 1 107428268 missense possibly damaging 0.72
R1789:Serpinb7 UTSW 1 107450273 missense possibly damaging 0.58
R1850:Serpinb7 UTSW 1 107428295 missense probably damaging 1.00
R2962:Serpinb7 UTSW 1 107451726 missense probably benign 0.00
R3151:Serpinb7 UTSW 1 107435351 nonsense probably null
R3439:Serpinb7 UTSW 1 107428351 missense probably damaging 1.00
R4064:Serpinb7 UTSW 1 107446036 missense probably benign 0.09
R4590:Serpinb7 UTSW 1 107451833 missense probably damaging 1.00
R5260:Serpinb7 UTSW 1 107434749 missense possibly damaging 0.74
R5637:Serpinb7 UTSW 1 107428307 missense probably damaging 1.00
R5914:Serpinb7 UTSW 1 107451850 missense probably damaging 1.00
R5992:Serpinb7 UTSW 1 107445996 missense probably damaging 1.00
R6013:Serpinb7 UTSW 1 107450189 missense probably benign
R6317:Serpinb7 UTSW 1 107451706 missense probably damaging 1.00
R6494:Serpinb7 UTSW 1 107435346 nonsense probably null
R7181:Serpinb7 UTSW 1 107450322 missense probably benign 0.01
R8226:Serpinb7 UTSW 1 107448250 splice site probably null
Predicted Primers PCR Primer
(F):5'- CTGCTTAAGACATTGACATTCATTTGG -3'
(R):5'- TGTCATATTGTCTGCAATCAAACTG -3'

Sequencing Primer
(F):5'- TTGGAATTGTGAGAAAAGTAAGCTC -3'
(R):5'- GAGTTATCTCCCATTTAGTTTC -3'
Posted On2020-01-23