Incidental Mutation 'R8011:Plekha6'
ID 616888
Institutional Source Beutler Lab
Gene Symbol Plekha6
Ensembl Gene ENSMUSG00000041757
Gene Name pleckstrin homology domain containing, family A member 6
Synonyms Pepp3
MMRRC Submission 046051-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.173) question?
Stock # R8011 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 133091948-133231173 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 133191544 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 38 (T38A)
Ref Sequence ENSEMBL: ENSMUSP00000048214 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038295] [ENSMUST00000105082] [ENSMUST00000186917] [ENSMUST00000187285] [ENSMUST00000212252]
AlphaFold Q7TQG1
Predicted Effect probably benign
Transcript: ENSMUST00000038295
AA Change: T38A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000048214
Gene: ENSMUSG00000041757
AA Change: T38A

DomainStartEndE-ValueType
PH 60 160 2.23e-20 SMART
low complexity region 217 231 N/A INTRINSIC
low complexity region 353 367 N/A INTRINSIC
Blast:PH 506 576 6e-31 BLAST
coiled coil region 613 686 N/A INTRINSIC
low complexity region 761 782 N/A INTRINSIC
low complexity region 789 808 N/A INTRINSIC
low complexity region 812 827 N/A INTRINSIC
low complexity region 1139 1153 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105082
AA Change: T38A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000100703
Gene: ENSMUSG00000041757
AA Change: T38A

DomainStartEndE-ValueType
PH 60 180 1.24e-18 SMART
low complexity region 237 251 N/A INTRINSIC
low complexity region 373 387 N/A INTRINSIC
coiled coil region 559 632 N/A INTRINSIC
low complexity region 707 728 N/A INTRINSIC
low complexity region 1035 1049 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000186917
AA Change: T38A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000139794
Gene: ENSMUSG00000041757
AA Change: T38A

DomainStartEndE-ValueType
PH 60 180 1.24e-18 SMART
low complexity region 237 251 N/A INTRINSIC
low complexity region 373 387 N/A INTRINSIC
coiled coil region 559 632 N/A INTRINSIC
low complexity region 707 728 N/A INTRINSIC
low complexity region 1035 1049 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000187285
AA Change: T38A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000140558
Gene: ENSMUSG00000041757
AA Change: T38A

DomainStartEndE-ValueType
PH 60 160 9.6e-23 SMART
low complexity region 217 231 N/A INTRINSIC
low complexity region 353 367 N/A INTRINSIC
coiled coil region 539 612 N/A INTRINSIC
low complexity region 687 708 N/A INTRINSIC
low complexity region 1014 1028 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000212252
AA Change: T142A

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 100% (46/46)
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik C T 9: 124,056,529 (GRCm39) E132K Het
Acss2 T C 2: 155,397,877 (GRCm39) I313T possibly damaging Het
Akap13 G A 7: 75,380,213 (GRCm39) R462H probably damaging Het
Ankrd27 T C 7: 35,316,306 (GRCm39) V524A probably benign Het
Cacna1e T C 1: 154,341,568 (GRCm39) I1209V probably benign Het
Cntn3 A T 6: 102,414,860 (GRCm39) I29N possibly damaging Het
Col5a1 G A 2: 27,870,533 (GRCm39) probably benign Het
Cttnbp2 G C 6: 18,426,092 (GRCm39) A762G possibly damaging Het
Edc3 C A 9: 57,620,659 (GRCm39) probably benign Het
Egflam A T 15: 7,276,525 (GRCm39) M547K possibly damaging Het
Fgr T C 4: 132,725,790 (GRCm39) Y400H probably damaging Het
Gaa C T 11: 119,163,762 (GRCm39) P205S probably benign Het
Gpr6 T A 10: 40,946,911 (GRCm39) T224S probably benign Het
Hes3 T C 4: 152,371,938 (GRCm39) probably benign Het
Hydin T C 8: 111,310,541 (GRCm39) F4079S probably damaging Het
Igf2bp2 A T 16: 21,894,849 (GRCm39) I366N probably damaging Het
Kmt2c A G 5: 25,556,232 (GRCm39) V1171A probably damaging Het
Kndc1 T A 7: 139,490,536 (GRCm39) F346Y possibly damaging Het
Lpin2 G A 17: 71,537,370 (GRCm39) G306R probably benign Het
Mok T C 12: 110,781,351 (GRCm39) probably benign Het
Nolc1 T C 19: 46,070,023 (GRCm39) V265A unknown Het
Ogfr GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG 2: 180,237,059 (GRCm39) probably benign Het
Or2ah1 T G 2: 85,653,957 (GRCm39) L214R possibly damaging Het
Or4c103 G A 2: 88,513,537 (GRCm39) Q180* probably null Het
Or5j1 A C 2: 86,879,190 (GRCm39) L130R probably damaging Het
Or6b2b A G 1: 92,418,997 (GRCm39) V160A possibly damaging Het
Parp14 G A 16: 35,677,004 (GRCm39) T988I probably benign Het
Pdk1 A T 2: 71,705,796 (GRCm39) Q81H probably benign Het
Pou2f1 A G 1: 165,722,472 (GRCm39) probably null Het
Rgs6 A G 12: 83,163,066 (GRCm39) D424G probably null Het
Rnf13 T G 3: 57,714,491 (GRCm39) Y183* probably null Het
Ryr2 A T 13: 11,603,026 (GRCm39) probably null Het
Serpinb7 T A 1: 107,362,487 (GRCm39) S64T possibly damaging Het
Six2 T C 17: 85,995,100 (GRCm39) E94G probably damaging Het
Slc44a5 A G 3: 153,953,447 (GRCm39) I276M possibly damaging Het
Smco2 A G 6: 146,769,633 (GRCm39) Y239C probably damaging Het
Ssx2ip T C 3: 146,128,666 (GRCm39) S148P probably damaging Het
Tiam2 T C 17: 3,498,671 (GRCm39) Y816H possibly damaging Het
Tnk2 C T 16: 32,487,183 (GRCm39) R127C probably benign Het
Tpd52l1 T C 10: 31,208,913 (GRCm39) N185S probably benign Het
Try5 T C 6: 41,290,421 (GRCm39) D21G probably benign Het
Vmn2r20 A G 6: 123,373,369 (GRCm39) V491A possibly damaging Het
Vps54 G T 11: 21,225,095 (GRCm39) R197L probably damaging Het
Xkr5 G T 8: 18,998,736 (GRCm39) Y27* probably null Het
Zfp1004 A G 2: 150,034,266 (GRCm39) S196G possibly damaging Het
Zfp626 T A 7: 27,518,140 (GRCm39) C374S possibly damaging Het
Other mutations in Plekha6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01098:Plekha6 APN 1 133,209,903 (GRCm39) missense possibly damaging 0.92
IGL01328:Plekha6 APN 1 133,200,074 (GRCm39) splice site probably null
IGL01739:Plekha6 APN 1 133,187,869 (GRCm39) missense probably benign 0.38
IGL01803:Plekha6 APN 1 133,200,152 (GRCm39) nonsense probably null
IGL02053:Plekha6 APN 1 133,200,230 (GRCm39) missense probably damaging 1.00
IGL02269:Plekha6 APN 1 133,215,587 (GRCm39) missense possibly damaging 0.82
IGL02276:Plekha6 APN 1 133,221,599 (GRCm39) missense possibly damaging 0.93
IGL02478:Plekha6 APN 1 133,211,031 (GRCm39) missense probably benign 0.03
IGL02754:Plekha6 APN 1 133,212,676 (GRCm39) missense probably damaging 0.98
G1Funyon:Plekha6 UTSW 1 133,192,425 (GRCm39) missense probably damaging 0.96
R0100:Plekha6 UTSW 1 133,197,915 (GRCm39) missense probably damaging 0.99
R0334:Plekha6 UTSW 1 133,209,918 (GRCm39) missense probably benign 0.24
R0470:Plekha6 UTSW 1 133,200,045 (GRCm39) missense probably benign 0.07
R1016:Plekha6 UTSW 1 133,187,832 (GRCm39) missense probably benign 0.00
R1254:Plekha6 UTSW 1 133,200,327 (GRCm39) missense probably benign 0.10
R1728:Plekha6 UTSW 1 133,215,584 (GRCm39) missense probably benign
R1729:Plekha6 UTSW 1 133,215,584 (GRCm39) missense probably benign
R1730:Plekha6 UTSW 1 133,215,584 (GRCm39) missense probably benign
R1739:Plekha6 UTSW 1 133,215,584 (GRCm39) missense probably benign
R1762:Plekha6 UTSW 1 133,215,584 (GRCm39) missense probably benign
R1771:Plekha6 UTSW 1 133,201,651 (GRCm39) missense probably benign 0.00
R1783:Plekha6 UTSW 1 133,215,584 (GRCm39) missense probably benign
R1784:Plekha6 UTSW 1 133,215,584 (GRCm39) missense probably benign
R1785:Plekha6 UTSW 1 133,215,584 (GRCm39) missense probably benign
R1786:Plekha6 UTSW 1 133,207,103 (GRCm39) splice site probably null
R1997:Plekha6 UTSW 1 133,191,556 (GRCm39) missense probably benign 0.43
R2020:Plekha6 UTSW 1 133,212,708 (GRCm39) missense possibly damaging 0.55
R2130:Plekha6 UTSW 1 133,207,103 (GRCm39) splice site probably null
R2131:Plekha6 UTSW 1 133,207,103 (GRCm39) splice site probably null
R2133:Plekha6 UTSW 1 133,207,103 (GRCm39) splice site probably null
R2992:Plekha6 UTSW 1 133,222,396 (GRCm39) missense probably damaging 1.00
R3781:Plekha6 UTSW 1 133,222,393 (GRCm39) missense probably damaging 1.00
R3810:Plekha6 UTSW 1 133,201,717 (GRCm39) missense probably benign
R4067:Plekha6 UTSW 1 133,222,416 (GRCm39) missense probably benign 0.40
R4725:Plekha6 UTSW 1 133,211,058 (GRCm39) missense probably damaging 1.00
R5657:Plekha6 UTSW 1 133,200,045 (GRCm39) missense possibly damaging 0.94
R5658:Plekha6 UTSW 1 133,200,045 (GRCm39) missense possibly damaging 0.94
R5746:Plekha6 UTSW 1 133,200,045 (GRCm39) missense possibly damaging 0.94
R5768:Plekha6 UTSW 1 133,208,116 (GRCm39) missense probably benign 0.01
R5785:Plekha6 UTSW 1 133,200,045 (GRCm39) missense possibly damaging 0.94
R5892:Plekha6 UTSW 1 133,200,045 (GRCm39) missense possibly damaging 0.94
R5937:Plekha6 UTSW 1 133,187,839 (GRCm39) missense possibly damaging 0.89
R5985:Plekha6 UTSW 1 133,200,045 (GRCm39) missense possibly damaging 0.94
R5986:Plekha6 UTSW 1 133,200,045 (GRCm39) missense possibly damaging 0.94
R6053:Plekha6 UTSW 1 133,200,045 (GRCm39) missense possibly damaging 0.94
R6072:Plekha6 UTSW 1 133,200,045 (GRCm39) missense possibly damaging 0.94
R6167:Plekha6 UTSW 1 133,207,145 (GRCm39) missense probably null 0.96
R6843:Plekha6 UTSW 1 133,202,616 (GRCm39) missense probably damaging 1.00
R6879:Plekha6 UTSW 1 133,187,793 (GRCm39) missense possibly damaging 0.95
R6912:Plekha6 UTSW 1 133,200,273 (GRCm39) missense probably benign 0.02
R6970:Plekha6 UTSW 1 133,191,556 (GRCm39) missense probably benign 0.43
R7041:Plekha6 UTSW 1 133,200,198 (GRCm39) missense possibly damaging 0.93
R7248:Plekha6 UTSW 1 133,203,586 (GRCm39) nonsense probably null
R7400:Plekha6 UTSW 1 133,201,762 (GRCm39) nonsense probably null
R7720:Plekha6 UTSW 1 133,221,445 (GRCm39) missense probably damaging 1.00
R7772:Plekha6 UTSW 1 133,097,760 (GRCm39) missense possibly damaging 0.57
R8301:Plekha6 UTSW 1 133,192,425 (GRCm39) missense probably damaging 0.96
R8387:Plekha6 UTSW 1 133,219,893 (GRCm39) splice site probably null
R8465:Plekha6 UTSW 1 133,197,778 (GRCm39) missense probably damaging 0.98
R8501:Plekha6 UTSW 1 133,215,575 (GRCm39) missense probably benign 0.34
R9025:Plekha6 UTSW 1 133,212,999 (GRCm39) missense probably benign 0.01
R9044:Plekha6 UTSW 1 133,201,688 (GRCm39) missense possibly damaging 0.95
R9044:Plekha6 UTSW 1 133,201,687 (GRCm39) missense probably benign 0.01
R9165:Plekha6 UTSW 1 133,200,375 (GRCm39) missense probably damaging 1.00
R9179:Plekha6 UTSW 1 133,214,085 (GRCm39) missense possibly damaging 0.90
R9186:Plekha6 UTSW 1 133,220,171 (GRCm39) missense probably damaging 1.00
R9188:Plekha6 UTSW 1 133,220,171 (GRCm39) missense probably damaging 1.00
R9321:Plekha6 UTSW 1 133,209,549 (GRCm39) missense probably damaging 0.98
Z1176:Plekha6 UTSW 1 133,200,209 (GRCm39) missense probably damaging 0.98
Z1176:Plekha6 UTSW 1 133,191,551 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACCCATGTTTGAGAATCGGAAG -3'
(R):5'- AACCTACCAAAGAGTGCTTGG -3'

Sequencing Primer
(F):5'- GAAGATCCACGCCTTTGAGTTAGC -3'
(R):5'- CAAAGAGTGCTTGGGCTGC -3'
Posted On 2020-01-23