Incidental Mutation 'R8011:Olfr1195'
ID616894
Institutional Source Beutler Lab
Gene Symbol Olfr1195
Ensembl Gene ENSMUSG00000075121
Gene Nameolfactory receptor 1195
SynonymsMOR230-12_p, GA_x6K02T2Q125-50163514-50162588, MOR230-4
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.122) question?
Stock #R8011 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location88681455-88689187 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 88683193 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 180 (Q180*)
Ref Sequence ENSEMBL: ENSMUSP00000149442 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081697] [ENSMUST00000099818] [ENSMUST00000213545] [ENSMUST00000213893] [ENSMUST00000216767]
Predicted Effect probably benign
Transcript: ENSMUST00000081697
SMART Domains Protein: ENSMUSP00000080399
Gene: ENSMUSG00000060827

DomainStartEndE-ValueType
Pfam:7tm_4 36 310 7.5e-51 PFAM
Pfam:7tm_1 46 292 7.3e-24 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000099818
AA Change: Q180*
SMART Domains Protein: ENSMUSP00000097406
Gene: ENSMUSG00000075121
AA Change: Q180*

DomainStartEndE-ValueType
Pfam:7tm_4 29 303 2.5e-47 PFAM
Pfam:7TM_GPCR_Srsx 32 300 1.6e-5 PFAM
Pfam:7tm_1 39 285 5.2e-17 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000213545
AA Change: Q180*
Predicted Effect probably benign
Transcript: ENSMUST00000213893
Predicted Effect probably benign
Transcript: ENSMUST00000216767
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 100% (46/46)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik C T 9: 124,293,899 E132K Het
Acss2 T C 2: 155,555,957 I313T possibly damaging Het
Akap13 G A 7: 75,730,465 R462H probably damaging Het
Ankrd27 T C 7: 35,616,881 V524A probably benign Het
Cacna1e T C 1: 154,465,822 I1209V probably benign Het
Cntn3 A T 6: 102,437,899 I29N possibly damaging Het
Col5a1 G A 2: 27,980,521 probably benign Het
Cttnbp2 G C 6: 18,426,093 A762G possibly damaging Het
Edc3 C A 9: 57,713,376 probably benign Het
Egflam A T 15: 7,247,044 M547K possibly damaging Het
Fgr T C 4: 132,998,479 Y400H probably damaging Het
Gaa C T 11: 119,272,936 P205S probably benign Het
Gm14139 A G 2: 150,192,346 S196G possibly damaging Het
Gpr6 T A 10: 41,070,915 T224S probably benign Het
Hes3 T C 4: 152,287,481 probably benign Het
Hydin T C 8: 110,583,909 F4079S probably damaging Het
Igf2bp2 A T 16: 22,076,099 I366N probably damaging Het
Kmt2c A G 5: 25,351,234 V1171A probably damaging Het
Kndc1 T A 7: 139,910,620 F346Y possibly damaging Het
Lpin2 G A 17: 71,230,375 G306R probably benign Het
Mok T C 12: 110,814,917 probably benign Het
Nolc1 T C 19: 46,081,584 V265A unknown Het
Ogfr GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG 2: 180,595,266 probably benign Het
Olfr1018 T G 2: 85,823,613 L214R possibly damaging Het
Olfr1106 A C 2: 87,048,846 L130R probably damaging Het
Olfr1415 A G 1: 92,491,275 V160A possibly damaging Het
Parp14 G A 16: 35,856,634 T988I probably benign Het
Pdk1 A T 2: 71,875,452 Q81H probably benign Het
Plekha6 A G 1: 133,263,806 T38A probably benign Het
Pou2f1 A G 1: 165,894,903 probably null Het
Rgs6 A G 12: 83,116,292 D424G probably null Het
Rnf13 T G 3: 57,807,070 Y183* probably null Het
Ryr2 A T 13: 11,588,140 probably null Het
Serpinb7 T A 1: 107,434,757 S64T possibly damaging Het
Six2 T C 17: 85,687,672 E94G probably damaging Het
Slc44a5 A G 3: 154,247,810 I276M possibly damaging Het
Smco2 A G 6: 146,868,135 Y239C probably damaging Het
Ssx2ip T C 3: 146,422,911 S148P probably damaging Het
Tiam2 T C 17: 3,448,396 Y816H possibly damaging Het
Tnk2 C T 16: 32,668,365 R127C probably benign Het
Tpd52l1 T C 10: 31,332,917 N185S probably benign Het
Try5 T C 6: 41,313,487 D21G probably benign Het
Vmn2r20 A G 6: 123,396,410 V491A possibly damaging Het
Vps54 G T 11: 21,275,095 R197L probably damaging Het
Xkr5 G T 8: 18,948,720 Y27* probably null Het
Zfp626 T A 7: 27,818,715 C374S possibly damaging Het
Other mutations in Olfr1195
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00907:Olfr1195 APN 2 88683294 missense probably benign
IGL01396:Olfr1195 APN 2 88683231 missense probably damaging 0.99
IGL02871:Olfr1195 APN 2 88683084 missense probably damaging 1.00
IGL03049:Olfr1195 APN 2 88683490 missense possibly damaging 0.49
R0408:Olfr1195 UTSW 2 88683655 missense probably benign 0.04
R1562:Olfr1195 UTSW 2 88683079 missense probably benign 0.01
R5308:Olfr1195 UTSW 2 88683405 missense probably benign 0.09
R5806:Olfr1195 UTSW 2 88683151 missense probably damaging 1.00
R6119:Olfr1195 UTSW 2 88683591 missense probably damaging 0.98
R6178:Olfr1195 UTSW 2 88683633 missense probably damaging 1.00
R6510:Olfr1195 UTSW 2 88682958 missense probably benign 0.07
R6919:Olfr1195 UTSW 2 88683684 missense possibly damaging 0.93
R7205:Olfr1195 UTSW 2 88683423 missense possibly damaging 0.78
R7253:Olfr1195 UTSW 2 88683625 missense possibly damaging 0.87
R7663:Olfr1195 UTSW 2 88683352 missense probably damaging 1.00
R8671:Olfr1195 UTSW 2 88683105 missense probably benign 0.42
R8674:Olfr1195 UTSW 2 88683430 missense probably benign
R8845:Olfr1195 UTSW 2 88683391 missense possibly damaging 0.64
Predicted Primers PCR Primer
(F):5'- CGTGTGTATATAAATATGCAGGGCAC -3'
(R):5'- CCATCTGTAAGCCTCTGCAC -3'

Sequencing Primer
(F):5'- GAGACACAAGTGAACAGAGCTTTTC -3'
(R):5'- GTAAGCCTCTGCACTATATGACC -3'
Posted On2020-01-23