Incidental Mutation 'R8011:Gm14139'
ID616895
Institutional Source Beutler Lab
Gene Symbol Gm14139
Ensembl Gene ENSMUSG00000079009
Gene Namepredicted gene 14139
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.085) question?
Stock #R8011 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location150181755-150193279 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 150192346 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 196 (S196G)
Ref Sequence ENSEMBL: ENSMUSP00000105552 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109926] [ENSMUST00000109929]
Predicted Effect possibly damaging
Transcript: ENSMUST00000109926
AA Change: S196G

PolyPhen 2 Score 0.702 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000105552
Gene: ENSMUSG00000079009
AA Change: S196G

DomainStartEndE-ValueType
Blast:KRAB 1 34 7e-15 BLAST
ZnF_C2H2 71 93 8.6e-5 SMART
ZnF_C2H2 99 121 1.76e-1 SMART
ZnF_C2H2 127 149 3.02e0 SMART
ZnF_C2H2 183 205 6.08e-5 SMART
ZnF_C2H2 211 233 1.04e-3 SMART
ZnF_C2H2 239 261 2.57e-3 SMART
ZnF_C2H2 267 289 1.06e-4 SMART
ZnF_C2H2 295 317 2.2e-2 SMART
ZnF_C2H2 323 345 4.47e-3 SMART
ZnF_C2H2 351 373 7.37e-4 SMART
ZnF_C2H2 379 401 4.24e-4 SMART
ZnF_C2H2 407 429 1.2e-3 SMART
ZnF_C2H2 435 457 2.61e-4 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000109929
AA Change: S227G

PolyPhen 2 Score 0.459 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000105555
Gene: ENSMUSG00000079009
AA Change: S227G

DomainStartEndE-ValueType
KRAB 3 65 1.65e-15 SMART
ZnF_C2H2 102 124 8.6e-5 SMART
ZnF_C2H2 130 152 1.76e-1 SMART
ZnF_C2H2 158 180 3.02e0 SMART
ZnF_C2H2 214 236 6.08e-5 SMART
ZnF_C2H2 242 264 1.04e-3 SMART
ZnF_C2H2 270 292 2.57e-3 SMART
ZnF_C2H2 298 320 1.06e-4 SMART
ZnF_C2H2 326 348 2.2e-2 SMART
ZnF_C2H2 354 376 4.47e-3 SMART
ZnF_C2H2 382 404 7.37e-4 SMART
ZnF_C2H2 410 432 4.24e-4 SMART
ZnF_C2H2 438 460 1.2e-3 SMART
ZnF_C2H2 466 488 2.61e-4 SMART
Meta Mutation Damage Score 0.1712 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 100% (46/46)
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik C T 9: 124,293,899 E132K Het
Acss2 T C 2: 155,555,957 I313T possibly damaging Het
Akap13 G A 7: 75,730,465 R462H probably damaging Het
Ankrd27 T C 7: 35,616,881 V524A probably benign Het
Cacna1e T C 1: 154,465,822 I1209V probably benign Het
Cntn3 A T 6: 102,437,899 I29N possibly damaging Het
Col5a1 G A 2: 27,980,521 probably benign Het
Cttnbp2 G C 6: 18,426,093 A762G possibly damaging Het
Edc3 C A 9: 57,713,376 probably benign Het
Egflam A T 15: 7,247,044 M547K possibly damaging Het
Fgr T C 4: 132,998,479 Y400H probably damaging Het
Gaa C T 11: 119,272,936 P205S probably benign Het
Gpr6 T A 10: 41,070,915 T224S probably benign Het
Hes3 T C 4: 152,287,481 probably benign Het
Hydin T C 8: 110,583,909 F4079S probably damaging Het
Igf2bp2 A T 16: 22,076,099 I366N probably damaging Het
Kmt2c A G 5: 25,351,234 V1171A probably damaging Het
Kndc1 T A 7: 139,910,620 F346Y possibly damaging Het
Lpin2 G A 17: 71,230,375 G306R probably benign Het
Mok T C 12: 110,814,917 probably benign Het
Nolc1 T C 19: 46,081,584 V265A unknown Het
Ogfr GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG 2: 180,595,266 probably benign Het
Olfr1018 T G 2: 85,823,613 L214R possibly damaging Het
Olfr1106 A C 2: 87,048,846 L130R probably damaging Het
Olfr1195 G A 2: 88,683,193 Q180* probably null Het
Olfr1415 A G 1: 92,491,275 V160A possibly damaging Het
Parp14 G A 16: 35,856,634 T988I probably benign Het
Pdk1 A T 2: 71,875,452 Q81H probably benign Het
Plekha6 A G 1: 133,263,806 T38A probably benign Het
Pou2f1 A G 1: 165,894,903 probably null Het
Rgs6 A G 12: 83,116,292 D424G probably null Het
Rnf13 T G 3: 57,807,070 Y183* probably null Het
Ryr2 A T 13: 11,588,140 probably null Het
Serpinb7 T A 1: 107,434,757 S64T possibly damaging Het
Six2 T C 17: 85,687,672 E94G probably damaging Het
Slc44a5 A G 3: 154,247,810 I276M possibly damaging Het
Smco2 A G 6: 146,868,135 Y239C probably damaging Het
Ssx2ip T C 3: 146,422,911 S148P probably damaging Het
Tiam2 T C 17: 3,448,396 Y816H possibly damaging Het
Tnk2 C T 16: 32,668,365 R127C probably benign Het
Tpd52l1 T C 10: 31,332,917 N185S probably benign Het
Try5 T C 6: 41,313,487 D21G probably benign Het
Vmn2r20 A G 6: 123,396,410 V491A possibly damaging Het
Vps54 G T 11: 21,275,095 R197L probably damaging Het
Xkr5 G T 8: 18,948,720 Y27* probably null Het
Zfp626 T A 7: 27,818,715 C374S possibly damaging Het
Other mutations in Gm14139
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0254:Gm14139 UTSW 2 150191864 missense possibly damaging 0.78
R0505:Gm14139 UTSW 2 150193080 nonsense probably null
R0562:Gm14139 UTSW 2 150192574 missense probably damaging 1.00
R1239:Gm14139 UTSW 2 150191971 missense possibly damaging 0.94
R1878:Gm14139 UTSW 2 150193069 missense probably damaging 1.00
R1966:Gm14139 UTSW 2 150191907 missense probably benign 0.00
R2001:Gm14139 UTSW 2 150192947 missense probably benign 0.00
R2208:Gm14139 UTSW 2 150193145 missense probably benign 0.40
R3110:Gm14139 UTSW 2 150192221 missense probably damaging 1.00
R3112:Gm14139 UTSW 2 150192221 missense probably damaging 1.00
R4135:Gm14139 UTSW 2 150181868 splice site probably benign
R4299:Gm14139 UTSW 2 150190733 missense probably damaging 1.00
R4579:Gm14139 UTSW 2 150192223 missense probably damaging 1.00
R4818:Gm14139 UTSW 2 150192061 missense probably damaging 1.00
R4894:Gm14139 UTSW 2 150191979 nonsense probably null
R5432:Gm14139 UTSW 2 150191981 missense possibly damaging 0.68
R5669:Gm14139 UTSW 2 150192178 missense probably benign 0.09
R6106:Gm14139 UTSW 2 150192805 missense probably damaging 1.00
R6857:Gm14139 UTSW 2 150192062 missense probably damaging 1.00
R7450:Gm14139 UTSW 2 150193126 missense probably benign 0.04
R8519:Gm14139 UTSW 2 150192780 missense probably benign 0.37
Predicted Primers PCR Primer
(F):5'- TCCTTTGCAAGAAAGAGTCATCT -3'
(R):5'- TCTTGCAAAGGATTTACCACATTCG -3'

Sequencing Primer
(F):5'- GCATTGTGACAAAGCCTCTG -3'
(R):5'- CCACATTCGTTACATTCAAAGGG -3'
Posted On2020-01-23