Incidental Mutation 'R8011:Ogfr'
ID616897
Institutional Source Beutler Lab
Gene Symbol Ogfr
Ensembl Gene ENSMUSG00000049401
Gene Nameopioid growth factor receptor
Synonyms2010013E17Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.470) question?
Stock #R8011 (G1)
Quality Score152.458
Status Not validated
Chromosome2
Chromosomal Location180589245-180595836 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG to GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG at 180595266 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000128718 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029087] [ENSMUST00000103059] [ENSMUST00000132527]
Predicted Effect probably benign
Transcript: ENSMUST00000029087
SMART Domains Protein: ENSMUSP00000029087
Gene: ENSMUSG00000049401

DomainStartEndE-ValueType
low complexity region 7 40 N/A INTRINSIC
Pfam:OGFr_N 76 283 2.3e-111 PFAM
low complexity region 358 369 N/A INTRINSIC
internal_repeat_1 459 483 4.08e-5 PROSPERO
internal_repeat_1 576 600 4.08e-5 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000103059
SMART Domains Protein: ENSMUSP00000099348
Gene: ENSMUSG00000027570

DomainStartEndE-ValueType
Pfam:Collagen 21 80 7.7e-12 PFAM
Pfam:Collagen 58 114 4.2e-9 PFAM
low complexity region 126 162 N/A INTRINSIC
Pfam:Collagen 174 236 4.1e-12 PFAM
Pfam:Collagen 213 292 8e-9 PFAM
internal_repeat_1 315 366 1.58e-12 PROSPERO
internal_repeat_2 360 382 2.94e-6 PROSPERO
low complexity region 384 396 N/A INTRINSIC
Pfam:Collagen 456 518 1.8e-11 PFAM
Pfam:Collagen 545 606 3.8e-11 PFAM
low complexity region 635 656 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000132527
SMART Domains Protein: ENSMUSP00000128718
Gene: ENSMUSG00000027570

DomainStartEndE-ValueType
Pfam:Collagen 21 80 7.9e-12 PFAM
Pfam:Collagen 58 114 4.3e-9 PFAM
Pfam:Collagen 109 166 4.5e-8 PFAM
Pfam:Collagen 174 236 4.2e-12 PFAM
Pfam:Collagen 213 292 8.2e-9 PFAM
internal_repeat_1 315 366 1.58e-12 PROSPERO
internal_repeat_2 360 382 2.94e-6 PROSPERO
low complexity region 384 396 N/A INTRINSIC
Pfam:Collagen 402 474 8.2e-8 PFAM
Pfam:Collagen 456 518 1.8e-11 PFAM
Pfam:Collagen 545 606 3.9e-11 PFAM
Pfam:Collagen 603 662 2.5e-8 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 100% (46/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a receptor for opioid growth factor (OGF), also known as [Met(5)]-enkephalin. OGF is a negative regulator of cell proliferation and tissue organization in a variety of processes. The encoded unbound receptor for OGF has been localized to the outer nuclear envelope, where it binds OGF and is translocated into the nucleus. The coding sequence of this gene contains a polymorphic region of 60 nt tandem imperfect repeat units. Several transcripts containing between zero and eight repeat units have been reported. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik C T 9: 124,293,899 E132K Het
Acss2 T C 2: 155,555,957 I313T possibly damaging Het
Akap13 G A 7: 75,730,465 R462H probably damaging Het
Ankrd27 T C 7: 35,616,881 V524A probably benign Het
Cacna1e T C 1: 154,465,822 I1209V probably benign Het
Cntn3 A T 6: 102,437,899 I29N possibly damaging Het
Col5a1 G A 2: 27,980,521 probably benign Het
Cttnbp2 G C 6: 18,426,093 A762G possibly damaging Het
Edc3 C A 9: 57,713,376 probably benign Het
Egflam A T 15: 7,247,044 M547K possibly damaging Het
Fgr T C 4: 132,998,479 Y400H probably damaging Het
Gaa C T 11: 119,272,936 P205S probably benign Het
Gm14139 A G 2: 150,192,346 S196G possibly damaging Het
Gpr6 T A 10: 41,070,915 T224S probably benign Het
Hes3 T C 4: 152,287,481 probably benign Het
Hydin T C 8: 110,583,909 F4079S probably damaging Het
Igf2bp2 A T 16: 22,076,099 I366N probably damaging Het
Kmt2c A G 5: 25,351,234 V1171A probably damaging Het
Kndc1 T A 7: 139,910,620 F346Y possibly damaging Het
Lpin2 G A 17: 71,230,375 G306R probably benign Het
Mok T C 12: 110,814,917 probably benign Het
Nolc1 T C 19: 46,081,584 V265A unknown Het
Olfr1018 T G 2: 85,823,613 L214R possibly damaging Het
Olfr1106 A C 2: 87,048,846 L130R probably damaging Het
Olfr1195 G A 2: 88,683,193 Q180* probably null Het
Olfr1415 A G 1: 92,491,275 V160A possibly damaging Het
Parp14 G A 16: 35,856,634 T988I probably benign Het
Pdk1 A T 2: 71,875,452 Q81H probably benign Het
Plekha6 A G 1: 133,263,806 T38A probably benign Het
Pou2f1 A G 1: 165,894,903 probably null Het
Rgs6 A G 12: 83,116,292 D424G probably null Het
Rnf13 T G 3: 57,807,070 Y183* probably null Het
Ryr2 A T 13: 11,588,140 probably null Het
Serpinb7 T A 1: 107,434,757 S64T possibly damaging Het
Six2 T C 17: 85,687,672 E94G probably damaging Het
Slc44a5 A G 3: 154,247,810 I276M possibly damaging Het
Smco2 A G 6: 146,868,135 Y239C probably damaging Het
Ssx2ip T C 3: 146,422,911 S148P probably damaging Het
Tiam2 T C 17: 3,448,396 Y816H possibly damaging Het
Tnk2 C T 16: 32,668,365 R127C probably benign Het
Tpd52l1 T C 10: 31,332,917 N185S probably benign Het
Try5 T C 6: 41,313,487 D21G probably benign Het
Vmn2r20 A G 6: 123,396,410 V491A possibly damaging Het
Vps54 G T 11: 21,275,095 R197L probably damaging Het
Xkr5 G T 8: 18,948,720 Y27* probably null Het
Zfp626 T A 7: 27,818,715 C374S possibly damaging Het
Other mutations in Ogfr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00480:Ogfr APN 2 180593562 unclassified probably benign
IGL02437:Ogfr APN 2 180589536 missense possibly damaging 0.72
IGL02602:Ogfr APN 2 180595437 missense possibly damaging 0.85
IGL02609:Ogfr APN 2 180592515 splice site probably benign
IGL03297:Ogfr APN 2 180594407 missense possibly damaging 0.93
BB017:Ogfr UTSW 2 180595266 unclassified probably benign
PIT4812001:Ogfr UTSW 2 180595511 missense possibly damaging 0.93
R0085:Ogfr UTSW 2 180591037 splice site probably null
R0398:Ogfr UTSW 2 180593699 missense probably damaging 0.99
R1313:Ogfr UTSW 2 180594630 missense probably benign
R1313:Ogfr UTSW 2 180594630 missense probably benign
R1468:Ogfr UTSW 2 180594750 missense probably damaging 1.00
R1468:Ogfr UTSW 2 180594750 missense probably damaging 1.00
R4747:Ogfr UTSW 2 180594423 missense probably damaging 0.99
R4902:Ogfr UTSW 2 180593725 unclassified probably benign
R5422:Ogfr UTSW 2 180595274 missense possibly damaging 0.63
R5422:Ogfr UTSW 2 180595275 missense probably benign 0.02
R5860:Ogfr UTSW 2 180592492 missense probably damaging 1.00
R5988:Ogfr UTSW 2 180594233 missense probably damaging 1.00
R6015:Ogfr UTSW 2 180594674 missense probably damaging 1.00
R6558:Ogfr UTSW 2 180595404 missense possibly damaging 0.93
R6721:Ogfr UTSW 2 180595428 missense possibly damaging 0.70
R7111:Ogfr UTSW 2 180595266 unclassified probably benign
R7201:Ogfr UTSW 2 180595094 unclassified probably benign
R7217:Ogfr UTSW 2 180595266 unclassified probably benign
R7243:Ogfr UTSW 2 180595266 unclassified probably benign
R7387:Ogfr UTSW 2 180595266 unclassified probably benign
R7563:Ogfr UTSW 2 180592507 critical splice donor site probably null
R7681:Ogfr UTSW 2 180595266 unclassified probably benign
R7844:Ogfr UTSW 2 180595057 unclassified probably benign
R7845:Ogfr UTSW 2 180595266 unclassified probably benign
R7848:Ogfr UTSW 2 180592433 missense probably damaging 1.00
R7930:Ogfr UTSW 2 180595266 unclassified probably benign
R7985:Ogfr UTSW 2 180595057 unclassified probably benign
R8039:Ogfr UTSW 2 180595266 unclassified probably benign
R8045:Ogfr UTSW 2 180595057 unclassified probably benign
R8094:Ogfr UTSW 2 180595266 unclassified probably benign
R8339:Ogfr UTSW 2 180595266 unclassified probably benign
R8464:Ogfr UTSW 2 180595057 unclassified probably benign
R8555:Ogfr UTSW 2 180595266 unclassified probably benign
R8557:Ogfr UTSW 2 180595266 unclassified probably benign
R8688:Ogfr UTSW 2 180595057 unclassified probably benign
R8703:Ogfr UTSW 2 180595266 unclassified probably benign
R8856:Ogfr UTSW 2 180595266 unclassified probably benign
RF022:Ogfr UTSW 2 180595266 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- GTGTCCTGAGTCCCAAAAGG -3'
(R):5'- AGTGTCAGAGTCAGGATCCTC -3'

Sequencing Primer
(F):5'- GACCCCAAAAGCCAGGTGG -3'
(R):5'- AGAGTCAGGATCCTCCCCCAG -3'
Posted On2020-01-23