Incidental Mutation 'R8011:Slc44a5'
ID616900
Institutional Source Beutler Lab
Gene Symbol Slc44a5
Ensembl Gene ENSMUSG00000028360
Gene Namesolute carrier family 44, member 5
SynonymsLOC242259
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.089) question?
Stock #R8011 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location153973436-154271722 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 154247810 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Methionine at position 276 (I276M)
Ref Sequence ENSEMBL: ENSMUSP00000087394 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089948]
Predicted Effect possibly damaging
Transcript: ENSMUST00000089948
AA Change: I276M

PolyPhen 2 Score 0.712 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000087394
Gene: ENSMUSG00000028360
AA Change: I276M

DomainStartEndE-ValueType
transmembrane domain 33 55 N/A INTRINSIC
transmembrane domain 234 256 N/A INTRINSIC
transmembrane domain 263 285 N/A INTRINSIC
Pfam:Choline_transpo 323 683 6.3e-114 PFAM
Meta Mutation Damage Score 0.1129 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 100% (46/46)
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik C T 9: 124,293,899 E132K Het
Acss2 T C 2: 155,555,957 I313T possibly damaging Het
Akap13 G A 7: 75,730,465 R462H probably damaging Het
Ankrd27 T C 7: 35,616,881 V524A probably benign Het
Cacna1e T C 1: 154,465,822 I1209V probably benign Het
Cntn3 A T 6: 102,437,899 I29N possibly damaging Het
Col5a1 G A 2: 27,980,521 probably benign Het
Cttnbp2 G C 6: 18,426,093 A762G possibly damaging Het
Edc3 C A 9: 57,713,376 probably benign Het
Egflam A T 15: 7,247,044 M547K possibly damaging Het
Fgr T C 4: 132,998,479 Y400H probably damaging Het
Gaa C T 11: 119,272,936 P205S probably benign Het
Gm14139 A G 2: 150,192,346 S196G possibly damaging Het
Gpr6 T A 10: 41,070,915 T224S probably benign Het
Hes3 T C 4: 152,287,481 probably benign Het
Hydin T C 8: 110,583,909 F4079S probably damaging Het
Igf2bp2 A T 16: 22,076,099 I366N probably damaging Het
Kmt2c A G 5: 25,351,234 V1171A probably damaging Het
Kndc1 T A 7: 139,910,620 F346Y possibly damaging Het
Lpin2 G A 17: 71,230,375 G306R probably benign Het
Mok T C 12: 110,814,917 probably benign Het
Nolc1 T C 19: 46,081,584 V265A unknown Het
Ogfr GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG 2: 180,595,266 probably benign Het
Olfr1018 T G 2: 85,823,613 L214R possibly damaging Het
Olfr1106 A C 2: 87,048,846 L130R probably damaging Het
Olfr1195 G A 2: 88,683,193 Q180* probably null Het
Olfr1415 A G 1: 92,491,275 V160A possibly damaging Het
Parp14 G A 16: 35,856,634 T988I probably benign Het
Pdk1 A T 2: 71,875,452 Q81H probably benign Het
Plekha6 A G 1: 133,263,806 T38A probably benign Het
Pou2f1 A G 1: 165,894,903 probably null Het
Rgs6 A G 12: 83,116,292 D424G probably null Het
Rnf13 T G 3: 57,807,070 Y183* probably null Het
Ryr2 A T 13: 11,588,140 probably null Het
Serpinb7 T A 1: 107,434,757 S64T possibly damaging Het
Six2 T C 17: 85,687,672 E94G probably damaging Het
Smco2 A G 6: 146,868,135 Y239C probably damaging Het
Ssx2ip T C 3: 146,422,911 S148P probably damaging Het
Tiam2 T C 17: 3,448,396 Y816H possibly damaging Het
Tnk2 C T 16: 32,668,365 R127C probably benign Het
Tpd52l1 T C 10: 31,332,917 N185S probably benign Het
Try5 T C 6: 41,313,487 D21G probably benign Het
Vmn2r20 A G 6: 123,396,410 V491A possibly damaging Het
Vps54 G T 11: 21,275,095 R197L probably damaging Het
Xkr5 G T 8: 18,948,720 Y27* probably null Het
Zfp626 T A 7: 27,818,715 C374S possibly damaging Het
Other mutations in Slc44a5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00321:Slc44a5 APN 3 154262939 missense probably damaging 1.00
IGL02187:Slc44a5 APN 3 154262917 missense probably benign 0.00
IGL02219:Slc44a5 APN 3 154239159 missense possibly damaging 0.76
IGL02220:Slc44a5 APN 3 154250971 missense possibly damaging 0.94
IGL02314:Slc44a5 APN 3 154256519 missense probably damaging 1.00
IGL02471:Slc44a5 APN 3 154256576 missense probably damaging 1.00
IGL02869:Slc44a5 APN 3 154251014 missense probably damaging 0.97
IGL03117:Slc44a5 APN 3 154251077 missense probably benign 0.15
IGL03144:Slc44a5 APN 3 154243540 missense possibly damaging 0.78
PIT4486001:Slc44a5 UTSW 3 154259022 missense possibly damaging 0.50
R0026:Slc44a5 UTSW 3 154240270 splice site probably benign
R0190:Slc44a5 UTSW 3 154239118 missense probably null 0.00
R0306:Slc44a5 UTSW 3 154270001 missense probably damaging 1.00
R0591:Slc44a5 UTSW 3 154234145 splice site probably benign
R0744:Slc44a5 UTSW 3 154265474 missense probably damaging 1.00
R0833:Slc44a5 UTSW 3 154265474 missense probably damaging 1.00
R0919:Slc44a5 UTSW 3 154243586 missense probably damaging 1.00
R1170:Slc44a5 UTSW 3 154257720 splice site probably null
R1370:Slc44a5 UTSW 3 154243159 missense probably benign 0.26
R1613:Slc44a5 UTSW 3 154257714 splice site probably null
R1713:Slc44a5 UTSW 3 154239106 missense probably damaging 0.97
R1999:Slc44a5 UTSW 3 154258493 missense possibly damaging 0.61
R2143:Slc44a5 UTSW 3 154258449 missense probably benign 0.01
R2293:Slc44a5 UTSW 3 154240297 missense probably benign 0.01
R2367:Slc44a5 UTSW 3 154247809 missense possibly damaging 0.94
R3842:Slc44a5 UTSW 3 154261394 splice site probably benign
R3953:Slc44a5 UTSW 3 154171572 missense probably benign 0.03
R4163:Slc44a5 UTSW 3 154261373 missense possibly damaging 0.94
R4509:Slc44a5 UTSW 3 154234073 missense probably damaging 1.00
R4657:Slc44a5 UTSW 3 154256584 missense possibly damaging 0.81
R4936:Slc44a5 UTSW 3 154253716 missense probably damaging 1.00
R4937:Slc44a5 UTSW 3 154243615 critical splice donor site probably null
R5083:Slc44a5 UTSW 3 154247787 missense probably benign 0.31
R5257:Slc44a5 UTSW 3 154243123 missense probably damaging 1.00
R5580:Slc44a5 UTSW 3 154261285 missense probably benign 0.03
R5586:Slc44a5 UTSW 3 154270165 utr 3 prime probably benign
R5856:Slc44a5 UTSW 3 154258392 missense possibly damaging 0.78
R5894:Slc44a5 UTSW 3 154256573 missense probably damaging 1.00
R6228:Slc44a5 UTSW 3 154239163 missense probably benign 0.00
R6248:Slc44a5 UTSW 3 154264041 missense possibly damaging 0.93
R6413:Slc44a5 UTSW 3 154257750 missense probably benign 0.21
R6454:Slc44a5 UTSW 3 154243159 missense probably benign 0.26
R6594:Slc44a5 UTSW 3 154259023 missense possibly damaging 0.85
R6761:Slc44a5 UTSW 3 154240077 splice site probably null
R6931:Slc44a5 UTSW 3 154258506 missense probably benign 0.03
R7027:Slc44a5 UTSW 3 154253719 missense probably benign 0.00
R7566:Slc44a5 UTSW 3 154269989 missense probably damaging 1.00
R7688:Slc44a5 UTSW 3 153973800 critical splice donor site probably null
R8085:Slc44a5 UTSW 3 154222777 missense probably damaging 1.00
R8460:Slc44a5 UTSW 3 154270030 missense probably benign 0.00
R8765:Slc44a5 UTSW 3 154262924 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCTCCCATCTGGATGTTCATG -3'
(R):5'- TGTAAGACCTGAGTCCAAAGAC -3'

Sequencing Primer
(F):5'- TCATGTTGTGTTGCATACAGC -3'
(R):5'- CTGCTAAGGAAAGGAGGAGCTTTTTC -3'
Posted On2020-01-23