Incidental Mutation 'R8011:Fgr'
ID616901
Institutional Source Beutler Lab
Gene Symbol Fgr
Ensembl Gene ENSMUSG00000028874
Gene NameFGR proto-oncogene, Src family tyrosine kinase
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.167) question?
Stock #R8011 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location132974095-133001910 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 132998479 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 400 (Y400H)
Ref Sequence ENSEMBL: ENSMUSP00000030693 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030693] [ENSMUST00000171223]
Predicted Effect probably damaging
Transcript: ENSMUST00000030693
AA Change: Y400H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000030693
Gene: ENSMUSG00000028874
AA Change: Y400H

DomainStartEndE-ValueType
SH3 68 125 5.39e-22 SMART
SH2 130 220 5.25e-36 SMART
TyrKc 251 500 5.5e-126 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000171223
AA Change: Y400H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000128411
Gene: ENSMUSG00000028874
AA Change: Y400H

DomainStartEndE-ValueType
SH3 68 125 5.39e-22 SMART
SH2 130 220 5.25e-36 SMART
TyrKc 251 500 5.5e-126 SMART
Meta Mutation Damage Score 0.7986 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 100% (46/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the Src family of protein tyrosine kinases (PTKs). The encoded protein contains N-terminal sites for myristylation and palmitylation, a PTK domain, and SH2 and SH3 domains which are involved in mediating protein-protein interactions with phosphotyrosine-containing and proline-rich motifs, respectively. The protein localizes to plasma membrane ruffles, and functions as a negative regulator of cell migration and adhesion triggered by the beta-2 integrin signal transduction pathway. Infection with Epstein-Barr virus results in the overexpression of this gene. Multiple alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit a partial reduction in hemorrhage following induction of a local Shwartzman reaction, and show enhanced NK-cell receptor-induced IFN-gamma production in natural killer (NK) cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik C T 9: 124,293,899 E132K Het
Acss2 T C 2: 155,555,957 I313T possibly damaging Het
Akap13 G A 7: 75,730,465 R462H probably damaging Het
Ankrd27 T C 7: 35,616,881 V524A probably benign Het
Cacna1e T C 1: 154,465,822 I1209V probably benign Het
Cntn3 A T 6: 102,437,899 I29N possibly damaging Het
Col5a1 G A 2: 27,980,521 probably benign Het
Cttnbp2 G C 6: 18,426,093 A762G possibly damaging Het
Edc3 C A 9: 57,713,376 probably benign Het
Egflam A T 15: 7,247,044 M547K possibly damaging Het
Gaa C T 11: 119,272,936 P205S probably benign Het
Gm14139 A G 2: 150,192,346 S196G possibly damaging Het
Gpr6 T A 10: 41,070,915 T224S probably benign Het
Hes3 T C 4: 152,287,481 probably benign Het
Hydin T C 8: 110,583,909 F4079S probably damaging Het
Igf2bp2 A T 16: 22,076,099 I366N probably damaging Het
Kmt2c A G 5: 25,351,234 V1171A probably damaging Het
Kndc1 T A 7: 139,910,620 F346Y possibly damaging Het
Lpin2 G A 17: 71,230,375 G306R probably benign Het
Mok T C 12: 110,814,917 probably benign Het
Nolc1 T C 19: 46,081,584 V265A unknown Het
Ogfr GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG 2: 180,595,266 probably benign Het
Olfr1018 T G 2: 85,823,613 L214R possibly damaging Het
Olfr1106 A C 2: 87,048,846 L130R probably damaging Het
Olfr1195 G A 2: 88,683,193 Q180* probably null Het
Olfr1415 A G 1: 92,491,275 V160A possibly damaging Het
Parp14 G A 16: 35,856,634 T988I probably benign Het
Pdk1 A T 2: 71,875,452 Q81H probably benign Het
Plekha6 A G 1: 133,263,806 T38A probably benign Het
Pou2f1 A G 1: 165,894,903 probably null Het
Rgs6 A G 12: 83,116,292 D424G probably null Het
Rnf13 T G 3: 57,807,070 Y183* probably null Het
Ryr2 A T 13: 11,588,140 probably null Het
Serpinb7 T A 1: 107,434,757 S64T possibly damaging Het
Six2 T C 17: 85,687,672 E94G probably damaging Het
Slc44a5 A G 3: 154,247,810 I276M possibly damaging Het
Smco2 A G 6: 146,868,135 Y239C probably damaging Het
Ssx2ip T C 3: 146,422,911 S148P probably damaging Het
Tiam2 T C 17: 3,448,396 Y816H possibly damaging Het
Tnk2 C T 16: 32,668,365 R127C probably benign Het
Tpd52l1 T C 10: 31,332,917 N185S probably benign Het
Try5 T C 6: 41,313,487 D21G probably benign Het
Vmn2r20 A G 6: 123,396,410 V491A possibly damaging Het
Vps54 G T 11: 21,275,095 R197L probably damaging Het
Xkr5 G T 8: 18,948,720 Y27* probably null Het
Zfp626 T A 7: 27,818,715 C374S possibly damaging Het
Other mutations in Fgr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02201:Fgr APN 4 132994924 missense probably damaging 0.99
IGL03089:Fgr APN 4 132986266 missense probably damaging 0.96
R1760:Fgr UTSW 4 132998342 missense possibly damaging 0.72
R1957:Fgr UTSW 4 132998362 missense probably benign
R2011:Fgr UTSW 4 132997521 missense probably damaging 1.00
R2109:Fgr UTSW 4 132998475 missense probably benign 0.32
R2351:Fgr UTSW 4 132997237 missense probably damaging 0.99
R2941:Fgr UTSW 4 132998423 missense probably benign
R3034:Fgr UTSW 4 132998496 critical splice donor site probably null
R4590:Fgr UTSW 4 132995053 missense probably damaging 1.00
R4770:Fgr UTSW 4 132987291 missense probably damaging 0.99
R4847:Fgr UTSW 4 132994648 missense probably damaging 1.00
R5294:Fgr UTSW 4 132997500 missense probably benign 0.01
R5384:Fgr UTSW 4 132986353 critical splice donor site probably null
R5388:Fgr UTSW 4 132995031 missense probably damaging 1.00
R5650:Fgr UTSW 4 133000222 missense probably benign 0.13
R6947:Fgr UTSW 4 132995069 critical splice donor site probably null
R7651:Fgr UTSW 4 132995013 missense probably damaging 1.00
R7686:Fgr UTSW 4 132998013 missense probably benign
R7921:Fgr UTSW 4 132986521 splice site probably null
R8238:Fgr UTSW 4 132997521 missense probably damaging 1.00
R8742:Fgr UTSW 4 132997517 missense probably damaging 1.00
Z1176:Fgr UTSW 4 133000170 missense probably benign 0.23
Predicted Primers PCR Primer
(F):5'- ATGCTAGCACCTGCCTCTCA -3'
(R):5'- AGCAATTTAGCAGTGCCTGA -3'

Sequencing Primer
(F):5'- AGCACCTGCCTCTCACTTCC -3'
(R):5'- CATTACAGATGGTTGTGAGCCACC -3'
Posted On2020-01-23