Incidental Mutation 'R8011:Try5'
ID616904
Institutional Source Beutler Lab
Gene Symbol Try5
Ensembl Gene ENSMUSG00000036938
Gene Nametrypsin 5
Synonyms1810049H19Rik, Tc
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.082) question?
Stock #R8011 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location41311233-41316841 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 41313487 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 21 (D21G)
Ref Sequence ENSEMBL: ENSMUSP00000064498 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064324] [ENSMUST00000173916]
Predicted Effect probably benign
Transcript: ENSMUST00000064324
AA Change: D21G

PolyPhen 2 Score 0.121 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000064498
Gene: ENSMUSG00000036938
AA Change: D21G

DomainStartEndE-ValueType
low complexity region 4 16 N/A INTRINSIC
Tryp_SPc 23 239 1.47e-104 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173916
SMART Domains Protein: ENSMUSP00000133640
Gene: ENSMUSG00000036938

DomainStartEndE-ValueType
Tryp_SPc 1 131 1.21e-27 SMART
Meta Mutation Damage Score 0.0704 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 100% (46/46)
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik C T 9: 124,293,899 E132K Het
Acss2 T C 2: 155,555,957 I313T possibly damaging Het
Akap13 G A 7: 75,730,465 R462H probably damaging Het
Ankrd27 T C 7: 35,616,881 V524A probably benign Het
Cacna1e T C 1: 154,465,822 I1209V probably benign Het
Cntn3 A T 6: 102,437,899 I29N possibly damaging Het
Col5a1 G A 2: 27,980,521 probably benign Het
Cttnbp2 G C 6: 18,426,093 A762G possibly damaging Het
Edc3 C A 9: 57,713,376 probably benign Het
Egflam A T 15: 7,247,044 M547K possibly damaging Het
Fgr T C 4: 132,998,479 Y400H probably damaging Het
Gaa C T 11: 119,272,936 P205S probably benign Het
Gm14139 A G 2: 150,192,346 S196G possibly damaging Het
Gpr6 T A 10: 41,070,915 T224S probably benign Het
Hes3 T C 4: 152,287,481 probably benign Het
Hydin T C 8: 110,583,909 F4079S probably damaging Het
Igf2bp2 A T 16: 22,076,099 I366N probably damaging Het
Kmt2c A G 5: 25,351,234 V1171A probably damaging Het
Kndc1 T A 7: 139,910,620 F346Y possibly damaging Het
Lpin2 G A 17: 71,230,375 G306R probably benign Het
Mok T C 12: 110,814,917 probably benign Het
Nolc1 T C 19: 46,081,584 V265A unknown Het
Ogfr GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG 2: 180,595,266 probably benign Het
Olfr1018 T G 2: 85,823,613 L214R possibly damaging Het
Olfr1106 A C 2: 87,048,846 L130R probably damaging Het
Olfr1195 G A 2: 88,683,193 Q180* probably null Het
Olfr1415 A G 1: 92,491,275 V160A possibly damaging Het
Parp14 G A 16: 35,856,634 T988I probably benign Het
Pdk1 A T 2: 71,875,452 Q81H probably benign Het
Plekha6 A G 1: 133,263,806 T38A probably benign Het
Pou2f1 A G 1: 165,894,903 probably null Het
Rgs6 A G 12: 83,116,292 D424G probably null Het
Rnf13 T G 3: 57,807,070 Y183* probably null Het
Ryr2 A T 13: 11,588,140 probably null Het
Serpinb7 T A 1: 107,434,757 S64T possibly damaging Het
Six2 T C 17: 85,687,672 E94G probably damaging Het
Slc44a5 A G 3: 154,247,810 I276M possibly damaging Het
Smco2 A G 6: 146,868,135 Y239C probably damaging Het
Ssx2ip T C 3: 146,422,911 S148P probably damaging Het
Tiam2 T C 17: 3,448,396 Y816H possibly damaging Het
Tnk2 C T 16: 32,668,365 R127C probably benign Het
Tpd52l1 T C 10: 31,332,917 N185S probably benign Het
Vmn2r20 A G 6: 123,396,410 V491A possibly damaging Het
Vps54 G T 11: 21,275,095 R197L probably damaging Het
Xkr5 G T 8: 18,948,720 Y27* probably null Het
Zfp626 T A 7: 27,818,715 C374S possibly damaging Het
Other mutations in Try5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01837:Try5 APN 6 41313424 missense probably benign 0.31
IGL01885:Try5 APN 6 41311738 missense possibly damaging 0.93
IGL02652:Try5 APN 6 41311408 missense probably benign 0.01
R1955:Try5 UTSW 6 41311769 missense probably benign 0.17
R2014:Try5 UTSW 6 41314651 splice site probably null
R2015:Try5 UTSW 6 41314651 splice site probably null
R2848:Try5 UTSW 6 41313476 missense probably benign 0.01
R4227:Try5 UTSW 6 41313467 missense possibly damaging 0.65
R4685:Try5 UTSW 6 41311299 missense possibly damaging 0.59
R4816:Try5 UTSW 6 41313415 missense probably benign 0.18
R5230:Try5 UTSW 6 41312378 missense probably benign 0.19
R5658:Try5 UTSW 6 41312427 missense probably damaging 1.00
R6518:Try5 UTSW 6 41314679 missense probably benign
R6910:Try5 UTSW 6 41311799 missense possibly damaging 0.62
R6913:Try5 UTSW 6 41311332 missense probably damaging 1.00
R7219:Try5 UTSW 6 41311703 missense probably damaging 1.00
R7242:Try5 UTSW 6 41313454 missense probably benign 0.09
R7444:Try5 UTSW 6 41311365 missense probably benign 0.00
R7575:Try5 UTSW 6 41311814 missense probably benign 0.05
R7585:Try5 UTSW 6 41311814 missense probably benign 0.14
R8739:Try5 UTSW 6 41311703 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGTCTAGTGGCACTGTTCTC -3'
(R):5'- TGTATGCATTAAGAACCCCTAGG -3'

Sequencing Primer
(F):5'- CTAGTGGCACTGTTCTCAGGTAAC -3'
(R):5'- CCTGGTGTACAACATGAGTTCCAG -3'
Posted On2020-01-23