Incidental Mutation 'R8011:Vmn2r20'
ID616906
Institutional Source Beutler Lab
Gene Symbol Vmn2r20
Ensembl Gene ENSMUSG00000094145
Gene Namevomeronasal 2, receptor 20
SynonymsEG667180
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.567) question?
Stock #R8011 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location123385262-123418061 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 123396410 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 491 (V491A)
Ref Sequence ENSEMBL: ENSMUSP00000129145 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000172199]
Predicted Effect possibly damaging
Transcript: ENSMUST00000172199
AA Change: V491A

PolyPhen 2 Score 0.708 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000129145
Gene: ENSMUSG00000094145
AA Change: V491A

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:ANF_receptor 81 473 5e-33 PFAM
Pfam:NCD3G 517 570 9.6e-24 PFAM
Pfam:7tm_3 601 838 1.4e-54 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 100% (46/46)
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik C T 9: 124,293,899 E132K Het
Acss2 T C 2: 155,555,957 I313T possibly damaging Het
Akap13 G A 7: 75,730,465 R462H probably damaging Het
Ankrd27 T C 7: 35,616,881 V524A probably benign Het
Cacna1e T C 1: 154,465,822 I1209V probably benign Het
Cntn3 A T 6: 102,437,899 I29N possibly damaging Het
Col5a1 G A 2: 27,980,521 probably benign Het
Cttnbp2 G C 6: 18,426,093 A762G possibly damaging Het
Edc3 C A 9: 57,713,376 probably benign Het
Egflam A T 15: 7,247,044 M547K possibly damaging Het
Fgr T C 4: 132,998,479 Y400H probably damaging Het
Gaa C T 11: 119,272,936 P205S probably benign Het
Gm14139 A G 2: 150,192,346 S196G possibly damaging Het
Gpr6 T A 10: 41,070,915 T224S probably benign Het
Hes3 T C 4: 152,287,481 probably benign Het
Hydin T C 8: 110,583,909 F4079S probably damaging Het
Igf2bp2 A T 16: 22,076,099 I366N probably damaging Het
Kmt2c A G 5: 25,351,234 V1171A probably damaging Het
Kndc1 T A 7: 139,910,620 F346Y possibly damaging Het
Lpin2 G A 17: 71,230,375 G306R probably benign Het
Mok T C 12: 110,814,917 probably benign Het
Nolc1 T C 19: 46,081,584 V265A unknown Het
Ogfr GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG 2: 180,595,266 probably benign Het
Olfr1018 T G 2: 85,823,613 L214R possibly damaging Het
Olfr1106 A C 2: 87,048,846 L130R probably damaging Het
Olfr1195 G A 2: 88,683,193 Q180* probably null Het
Olfr1415 A G 1: 92,491,275 V160A possibly damaging Het
Parp14 G A 16: 35,856,634 T988I probably benign Het
Pdk1 A T 2: 71,875,452 Q81H probably benign Het
Plekha6 A G 1: 133,263,806 T38A probably benign Het
Pou2f1 A G 1: 165,894,903 probably null Het
Rgs6 A G 12: 83,116,292 D424G probably null Het
Rnf13 T G 3: 57,807,070 Y183* probably null Het
Ryr2 A T 13: 11,588,140 probably null Het
Serpinb7 T A 1: 107,434,757 S64T possibly damaging Het
Six2 T C 17: 85,687,672 E94G probably damaging Het
Slc44a5 A G 3: 154,247,810 I276M possibly damaging Het
Smco2 A G 6: 146,868,135 Y239C probably damaging Het
Ssx2ip T C 3: 146,422,911 S148P probably damaging Het
Tiam2 T C 17: 3,448,396 Y816H possibly damaging Het
Tnk2 C T 16: 32,668,365 R127C probably benign Het
Tpd52l1 T C 10: 31,332,917 N185S probably benign Het
Try5 T C 6: 41,313,487 D21G probably benign Het
Vps54 G T 11: 21,275,095 R197L probably damaging Het
Xkr5 G T 8: 18,948,720 Y27* probably null Het
Zfp626 T A 7: 27,818,715 C374S possibly damaging Het
Other mutations in Vmn2r20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01915:Vmn2r20 APN 6 123393965 missense possibly damaging 0.89
IGL02653:Vmn2r20 APN 6 123385365 missense probably damaging 1.00
IGL02686:Vmn2r20 APN 6 123385626 missense probably benign 0.00
R0309:Vmn2r20 UTSW 6 123386104 missense probably benign 0.18
R3724:Vmn2r20 UTSW 6 123385747 missense probably benign 0.00
R6502:Vmn2r20 UTSW 6 123396383 missense possibly damaging 0.51
R7039:Vmn2r20 UTSW 6 123386123 missense probably damaging 0.98
R7218:Vmn2r20 UTSW 6 123386115 missense probably damaging 1.00
R7372:Vmn2r20 UTSW 6 123385509 missense probably damaging 1.00
R7509:Vmn2r20 UTSW 6 123385423 missense probably benign 0.00
R7832:Vmn2r20 UTSW 6 123385923 missense probably damaging 1.00
R8118:Vmn2r20 UTSW 6 123396470 missense probably damaging 1.00
R8839:Vmn2r20 UTSW 6 123396556 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- CTCTTCCTAGGCCAAAACCTG -3'
(R):5'- CACAGGAACATACAGTTTGAGAC -3'

Sequencing Primer
(F):5'- AGGCCAAAACCTGATTGCTTCTG -3'
(R):5'- GTGCAAGTTCTGAACATTACTTTTG -3'
Posted On2020-01-23