Mutagenetix > Incidental Mutation

Incidental Mutation 'R8011:Vps54'

616917

Institutional Source

Beutler Lab

Gene Symbol

Vps54

Ensembl Gene

ENSMUSG00000020128

Gene Name

VPS54 GARP complex subunit

Synonyms

5330404P15Rik, wr, mSLP8, Vps54l

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.918) question?

Stock #

R8011 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

21239281-21321136 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 21275095 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Leucine at position 197 (R197L)

Ref Sequence

ENSEMBL: ENSMUSP00000006221 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000006221] [ENSMUST00000109578] [ENSMUST00000132017]

AlphaFold

Q5SPW0

PDB Structure

C-terminal domain of Vps54 subunit of the GARP complex [X-RAY DIFFRACTION]
Vps54 C-terminal domain [X-RAY DIFFRACTION]

Predicted Effect

probably damaging
Transcript: ENSMUST00000006221
AA Change: R197L

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000006221
Gene: ENSMUSG00000020128
AA Change: R197L

Domain	Start	End	E-Value	Type
low complexity region	3	16	N/A	INTRINSIC
Pfam:DUF2450	198	364	2.1e-12	PFAM
Pfam:Vps54	736	868	3.3e-56	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000109578
AA Change: R185L

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000105206
Gene: ENSMUSG00000020128
AA Change: R185L

Domain	Start	End	E-Value	Type
low complexity region	3	16	N/A	INTRINSIC
Pfam:DUF2450	186	352	2.3e-12	PFAM
Pfam:Vps54	723	857	1.6e-63	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000132017
AA Change: R71L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000116739
Gene: ENSMUSG00000020128
AA Change: R71L

Domain	Start	End	E-Value	Type
Pfam:DUF2450	72	238	1.4e-12	PFAM
Pfam:Vps54	573	707	7.8e-64	PFAM

Meta Mutation Damage Score

0.1162

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.4%

Validation Efficiency

100% (46/46)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes for a protein that in yeast forms part of a trimeric vacuolar-protein-sorting complex that is required for retrograde transport of proteins from prevacuoles to the late Golgi compartment. As in yeast, mammalian Vps54 proteins contain a coiled-coil region and dileucine motifs. Alternative splicing results in multiple transcript variants encoding different isoforms [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutants show progressive ataxia, tremors, and limb paralysis with degeneration of motor nerve cells of brainstem and spinal cord and atrophy of skeletal muscle beginning about 3-weeks of age. Mutants are sterile and most die by 3-months of age. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 46 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2010315B03Rik	C	T	9: 124,293,899	E132K		Het
Acss2	T	C	2: 155,555,957	I313T	possibly damaging	Het
Akap13	G	A	7: 75,730,465	R462H	probably damaging	Het
Ankrd27	T	C	7: 35,616,881	V524A	probably benign	Het
Cacna1e	T	C	1: 154,465,822	I1209V	probably benign	Het
Cntn3	A	T	6: 102,437,899	I29N	possibly damaging	Het
Col5a1	G	A	2: 27,980,521		probably benign	Het
Cttnbp2	G	C	6: 18,426,093	A762G	possibly damaging	Het
Edc3	C	A	9: 57,713,376		probably benign	Het
Egflam	A	T	15: 7,247,044	M547K	possibly damaging	Het
Fgr	T	C	4: 132,998,479	Y400H	probably damaging	Het
Gaa	C	T	11: 119,272,936	P205S	probably benign	Het
Gm14139	A	G	2: 150,192,346	S196G	possibly damaging	Het
Gpr6	T	A	10: 41,070,915	T224S	probably benign	Het
Hes3	T	C	4: 152,287,481		probably benign	Het
Hydin	T	C	8: 110,583,909	F4079S	probably damaging	Het
Igf2bp2	A	T	16: 22,076,099	I366N	probably damaging	Het
Kmt2c	A	G	5: 25,351,234	V1171A	probably damaging	Het
Kndc1	T	A	7: 139,910,620	F346Y	possibly damaging	Het
Lpin2	G	A	17: 71,230,375	G306R	probably benign	Het
Mok	T	C	12: 110,814,917		probably benign	Het
Nolc1	T	C	19: 46,081,584	V265A	unknown	Het
Ogfr	GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG	GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG	2: 180,595,266		probably benign	Het
Olfr1018	T	G	2: 85,823,613	L214R	possibly damaging	Het
Olfr1106	A	C	2: 87,048,846	L130R	probably damaging	Het
Olfr1195	G	A	2: 88,683,193	Q180*	probably null	Het
Olfr1415	A	G	1: 92,491,275	V160A	possibly damaging	Het
Parp14	G	A	16: 35,856,634	T988I	probably benign	Het
Pdk1	A	T	2: 71,875,452	Q81H	probably benign	Het
Plekha6	A	G	1: 133,263,806	T38A	probably benign	Het
Pou2f1	A	G	1: 165,894,903		probably null	Het
Rgs6	A	G	12: 83,116,292	D424G	probably null	Het
Rnf13	T	G	3: 57,807,070	Y183*	probably null	Het
Ryr2	A	T	13: 11,588,140		probably null	Het
Serpinb7	T	A	1: 107,434,757	S64T	possibly damaging	Het
Six2	T	C	17: 85,687,672	E94G	probably damaging	Het
Slc44a5	A	G	3: 154,247,810	I276M	possibly damaging	Het
Smco2	A	G	6: 146,868,135	Y239C	probably damaging	Het
Ssx2ip	T	C	3: 146,422,911	S148P	probably damaging	Het
Tiam2	T	C	17: 3,448,396	Y816H	possibly damaging	Het
Tnk2	C	T	16: 32,668,365	R127C	probably benign	Het
Tpd52l1	T	C	10: 31,332,917	N185S	probably benign	Het
Try5	T	C	6: 41,313,487	D21G	probably benign	Het
Vmn2r20	A	G	6: 123,396,410	V491A	possibly damaging	Het
Xkr5	G	T	8: 18,948,720	Y27*	probably null	Het
Zfp626	T	A	7: 27,818,715	C374S	possibly damaging	Het

Other mutations in Vps54

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00272:Vps54	APN	11	21277909	missense	possibly damaging	0.74
IGL01070:Vps54	APN	11	21312268	missense	probably damaging	1.00
IGL01398:Vps54	APN	11	21295403	splice site	probably benign
IGL01450:Vps54	APN	11	21291135	missense	probably benign	0.00
IGL01611:Vps54	APN	11	21311082	missense	probably damaging	1.00
IGL01801:Vps54	APN	11	21275131	critical splice donor site	probably null
IGL01872:Vps54	APN	11	21306940	missense	probably damaging	0.99
IGL02071:Vps54	APN	11	21275071	missense	probably null	0.00
IGL02186:Vps54	APN	11	21306947	missense	probably damaging	1.00
IGL03358:Vps54	APN	11	21268799	missense	probably damaging	1.00
muddle	UTSW	11	21277670	splice site	probably null
R0031:Vps54	UTSW	11	21312899	missense	probably damaging	1.00
R0147:Vps54	UTSW	11	21300259	missense	probably benign	0.02
R0158:Vps54	UTSW	11	21306962	missense	probably damaging	1.00
R0385:Vps54	UTSW	11	21306381	missense	possibly damaging	0.94
R0420:Vps54	UTSW	11	21311071	splice site	probably benign
R0582:Vps54	UTSW	11	21300137	missense	probably damaging	1.00
R0602:Vps54	UTSW	11	21306434	missense	possibly damaging	0.92
R1051:Vps54	UTSW	11	21278001	frame shift	probably null
R1280:Vps54	UTSW	11	21277868	missense	possibly damaging	0.88
R1720:Vps54	UTSW	11	21306519	missense	probably damaging	1.00
R1875:Vps54	UTSW	11	21300251	missense	probably benign	0.00
R1883:Vps54	UTSW	11	21312967	missense	possibly damaging	0.91
R1971:Vps54	UTSW	11	21292051	missense	probably damaging	1.00
R2063:Vps54	UTSW	11	21277955	missense	probably damaging	1.00
R2171:Vps54	UTSW	11	21298810	missense	probably benign	0.16
R2518:Vps54	UTSW	11	21306394	missense	probably benign	0.01
R3801:Vps54	UTSW	11	21268832	missense	probably benign	0.00
R4049:Vps54	UTSW	11	21300183	missense	probably benign	0.00
R4108:Vps54	UTSW	11	21312877	missense	probably benign	0.02
R4560:Vps54	UTSW	11	21312260	missense	possibly damaging	0.91
R4668:Vps54	UTSW	11	21299989	missense	probably benign	0.04
R4772:Vps54	UTSW	11	21312952	missense	probably damaging	1.00
R5061:Vps54	UTSW	11	21319881	utr 3 prime	probably benign
R5611:Vps54	UTSW	11	21311130	missense	possibly damaging	0.65
R5638:Vps54	UTSW	11	21308799	missense	probably damaging	1.00
R5670:Vps54	UTSW	11	21264864	missense	probably damaging	1.00
R7095:Vps54	UTSW	11	21271720	missense	probably benign	0.12
R7175:Vps54	UTSW	11	21315028	critical splice donor site	probably null
R7179:Vps54	UTSW	11	21298791	missense	probably damaging	1.00
R7269:Vps54	UTSW	11	21277670	splice site	probably null
R7286:Vps54	UTSW	11	21275005	missense	probably benign	0.30
R7344:Vps54	UTSW	11	21274999	missense	probably damaging	1.00
R7552:Vps54	UTSW	11	21298831	missense	probably benign	0.08
R7897:Vps54	UTSW	11	21263307	missense	probably benign	0.02
R8193:Vps54	UTSW	11	21292045	missense	probably benign	0.00
R8282:Vps54	UTSW	11	21300464	intron	probably benign
R8534:Vps54	UTSW	11	21277706	missense	probably benign	0.05
R8559:Vps54	UTSW	11	21264815	missense	probably damaging	1.00
R9034:Vps54	UTSW	11	21263273	missense	probably benign	0.29
R9096:Vps54	UTSW	11	21277913	missense	possibly damaging	0.90
R9253:Vps54	UTSW	11	21308771	missense	probably benign
R9359:Vps54	UTSW	11	21292108	missense	probably benign
R9367:Vps54	UTSW	11	21300234	missense	probably benign	0.00
Z1177:Vps54	UTSW	11	21263206	start gained	probably benign

Predicted Primers

PCR Primer
(F):5'- TTGCCTTTTACATTCAAGATCCAAG -3'
(R):5'- TCAGGGTTAACTATGAGTGGCAAC -3'

Sequencing Primer
(F):5'- ATCCAAGTTAATTTTGTTTCATGGTC -3'
(R):5'- ACTTGACCTGCTATGGATGAAGCC -3'

Posted On

2020-01-23