Incidental Mutation 'R8011:Rgs6'
ID616919
Institutional Source Beutler Lab
Gene Symbol Rgs6
Ensembl Gene ENSMUSG00000021219
Gene Nameregulator of G-protein signaling 6
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.150) question?
Stock #R8011 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location82588292-83162056 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 83116292 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 424 (D424G)
Ref Sequence ENSEMBL: ENSMUSP00000143801 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000101234] [ENSMUST00000185665] [ENSMUST00000185674] [ENSMUST00000186081] [ENSMUST00000186309] [ENSMUST00000186323] [ENSMUST00000186458] [ENSMUST00000186848] [ENSMUST00000191107] [ENSMUST00000191311] [ENSMUST00000191352] [ENSMUST00000200911] [ENSMUST00000202210]
Predicted Effect probably benign
Transcript: ENSMUST00000101234
AA Change: D424G

PolyPhen 2 Score 0.323 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000098793
Gene: ENSMUSG00000021219
AA Change: D424G

DomainStartEndE-ValueType
DEP 40 115 3.28e-24 SMART
G_gamma 255 319 2.23e-23 SMART
GGL 258 319 1.38e-27 SMART
RGS 336 451 2.05e-47 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000185665
AA Change: D424G

PolyPhen 2 Score 0.323 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000139566
Gene: ENSMUSG00000021219
AA Change: D424G

DomainStartEndE-ValueType
DEP 40 115 1.5e-26 SMART
G_gamma 255 319 1e-27 SMART
GGL 258 319 8.7e-30 SMART
RGS 336 451 7.5e-50 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000185674
AA Change: D387G

PolyPhen 2 Score 0.803 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000139940
Gene: ENSMUSG00000021219
AA Change: D387G

DomainStartEndE-ValueType
DEP 40 115 1.5e-26 SMART
RGS 299 414 7.5e-50 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000186081
AA Change: D424G

PolyPhen 2 Score 0.323 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000140188
Gene: ENSMUSG00000021219
AA Change: D424G

DomainStartEndE-ValueType
DEP 40 115 1.5e-26 SMART
RGS 299 414 7.5e-50 SMART
low complexity region 417 425 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000186309
AA Change: D424G

PolyPhen 2 Score 0.323 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000140701
Gene: ENSMUSG00000021219
AA Change: D424G

DomainStartEndE-ValueType
DEP 40 115 1.5e-26 SMART
G_gamma 255 319 1e-27 SMART
GGL 258 319 8.7e-30 SMART
RGS 336 451 7.5e-50 SMART
low complexity region 494 499 N/A INTRINSIC
low complexity region 511 523 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000186323
AA Change: D387G

PolyPhen 2 Score 0.803 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000141079
Gene: ENSMUSG00000021219
AA Change: D387G

DomainStartEndE-ValueType
DEP 40 115 1.5e-26 SMART
RGS 299 414 7.5e-50 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000186458
AA Change: D424G

PolyPhen 2 Score 0.323 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000139735
Gene: ENSMUSG00000021219
AA Change: D424G

DomainStartEndE-ValueType
DEP 40 115 3.28e-24 SMART
G_gamma 255 319 2.23e-23 SMART
GGL 258 319 1.38e-27 SMART
RGS 336 451 2.05e-47 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000186848
AA Change: D389G

PolyPhen 2 Score 0.323 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000141044
Gene: ENSMUSG00000021219
AA Change: D389G

DomainStartEndE-ValueType
DEP 5 80 1.6e-26 SMART
G_gamma 220 284 1.1e-27 SMART
GGL 223 284 8.8e-30 SMART
RGS 301 416 7.6e-50 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000191107
AA Change: D424G

PolyPhen 2 Score 0.323 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000139725
Gene: ENSMUSG00000021219
AA Change: D424G

DomainStartEndE-ValueType
DEP 40 115 1.5e-26 SMART
G_gamma 255 319 1e-27 SMART
GGL 258 319 8.7e-30 SMART
RGS 336 451 7.5e-50 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000191311
AA Change: D424G

PolyPhen 2 Score 0.803 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000140723
Gene: ENSMUSG00000021219
AA Change: D424G

DomainStartEndE-ValueType
DEP 40 115 1.5e-26 SMART
G_gamma 255 319 1e-27 SMART
GGL 258 319 8.7e-30 SMART
RGS 336 451 7.5e-50 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000191352
AA Change: D424G

PolyPhen 2 Score 0.860 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000139718
Gene: ENSMUSG00000021219
AA Change: D424G

DomainStartEndE-ValueType
DEP 40 115 1.5e-26 SMART
G_gamma 255 319 1e-27 SMART
GGL 258 319 8.7e-30 SMART
RGS 336 451 7.5e-50 SMART
Predicted Effect probably null
Transcript: ENSMUST00000200911
AA Change: D424G

PolyPhen 2 Score 0.323 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000143801
Gene: ENSMUSG00000021219
AA Change: D424G

DomainStartEndE-ValueType
DEP 40 115 3.28e-24 SMART
G_gamma 255 319 2.23e-23 SMART
GGL 258 319 1.38e-27 SMART
RGS 336 451 2.05e-47 SMART
Predicted Effect
Predicted Effect probably benign
Transcript: ENSMUST00000202210
AA Change: D424G

PolyPhen 2 Score 0.323 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000143961
Gene: ENSMUSG00000021219
AA Change: D424G

DomainStartEndE-ValueType
DEP 40 115 3.28e-24 SMART
G_gamma 255 319 2.23e-23 SMART
GGL 258 319 1.38e-27 SMART
RGS 336 451 2.05e-47 SMART
Meta Mutation Damage Score 0.1429 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 100% (46/46)
MGI Phenotype FUNCTION: This gene encodes a member of the RGS (regulator of G protein signaling) family of proteins, which are defined by the presence of a RGS domain that confers the GTPase-activating activity of these proteins toward certain G alpha subunits. This protein also belongs to a subfamily of RGS proteins characterized by the presence of DEP (Dishevelled, Egl-10, and Pleckstrin) and GGL (G-protein gamma like)domains, the latter a G beta 5-interacting domain. The RGS proteins negatively regulate G protein signaling, and may modulate neuronal, cardiovascular, lymphocytic activities, and cancer risk. Mice lacking this gene exhibit decreased heart rate. Alternative splicing results in multiple transcript variants, however, the full-length nature of some of these variants is not known. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased heart rate and abnormal impulse conducting system conduction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik C T 9: 124,293,899 E132K Het
Acss2 T C 2: 155,555,957 I313T possibly damaging Het
Akap13 G A 7: 75,730,465 R462H probably damaging Het
Ankrd27 T C 7: 35,616,881 V524A probably benign Het
Cacna1e T C 1: 154,465,822 I1209V probably benign Het
Cntn3 A T 6: 102,437,899 I29N possibly damaging Het
Col5a1 G A 2: 27,980,521 probably benign Het
Cttnbp2 G C 6: 18,426,093 A762G possibly damaging Het
Edc3 C A 9: 57,713,376 probably benign Het
Egflam A T 15: 7,247,044 M547K possibly damaging Het
Fgr T C 4: 132,998,479 Y400H probably damaging Het
Gaa C T 11: 119,272,936 P205S probably benign Het
Gm14139 A G 2: 150,192,346 S196G possibly damaging Het
Gpr6 T A 10: 41,070,915 T224S probably benign Het
Hes3 T C 4: 152,287,481 probably benign Het
Hydin T C 8: 110,583,909 F4079S probably damaging Het
Igf2bp2 A T 16: 22,076,099 I366N probably damaging Het
Kmt2c A G 5: 25,351,234 V1171A probably damaging Het
Kndc1 T A 7: 139,910,620 F346Y possibly damaging Het
Lpin2 G A 17: 71,230,375 G306R probably benign Het
Mok T C 12: 110,814,917 probably benign Het
Nolc1 T C 19: 46,081,584 V265A unknown Het
Ogfr GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG 2: 180,595,266 probably benign Het
Olfr1018 T G 2: 85,823,613 L214R possibly damaging Het
Olfr1106 A C 2: 87,048,846 L130R probably damaging Het
Olfr1195 G A 2: 88,683,193 Q180* probably null Het
Olfr1415 A G 1: 92,491,275 V160A possibly damaging Het
Parp14 G A 16: 35,856,634 T988I probably benign Het
Pdk1 A T 2: 71,875,452 Q81H probably benign Het
Plekha6 A G 1: 133,263,806 T38A probably benign Het
Pou2f1 A G 1: 165,894,903 probably null Het
Rnf13 T G 3: 57,807,070 Y183* probably null Het
Ryr2 A T 13: 11,588,140 probably null Het
Serpinb7 T A 1: 107,434,757 S64T possibly damaging Het
Six2 T C 17: 85,687,672 E94G probably damaging Het
Slc44a5 A G 3: 154,247,810 I276M possibly damaging Het
Smco2 A G 6: 146,868,135 Y239C probably damaging Het
Ssx2ip T C 3: 146,422,911 S148P probably damaging Het
Tiam2 T C 17: 3,448,396 Y816H possibly damaging Het
Tnk2 C T 16: 32,668,365 R127C probably benign Het
Tpd52l1 T C 10: 31,332,917 N185S probably benign Het
Try5 T C 6: 41,313,487 D21G probably benign Het
Vmn2r20 A G 6: 123,396,410 V491A possibly damaging Het
Vps54 G T 11: 21,275,095 R197L probably damaging Het
Xkr5 G T 8: 18,948,720 Y27* probably null Het
Zfp626 T A 7: 27,818,715 C374S possibly damaging Het
Other mutations in Rgs6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00502:Rgs6 APN 12 83051323 missense probably benign 0.01
IGL02131:Rgs6 APN 12 83069495 missense probably damaging 1.00
IGL02354:Rgs6 APN 12 82618619 intron probably benign
IGL02361:Rgs6 APN 12 82618619 intron probably benign
IGL02568:Rgs6 APN 12 83070602 missense probably benign 0.25
IGL02598:Rgs6 APN 12 83091797 missense probably benign 0.02
IGL03146:Rgs6 APN 12 83052538 missense probably damaging 1.00
IGL03248:Rgs6 APN 12 83052550 splice site probably benign
IGL03098:Rgs6 UTSW 12 82985376 missense probably damaging 1.00
IGL03147:Rgs6 UTSW 12 83091846 missense probably damaging 0.99
PIT4453001:Rgs6 UTSW 12 83091779 missense probably damaging 1.00
R0270:Rgs6 UTSW 12 83133689 missense probably damaging 1.00
R0390:Rgs6 UTSW 12 83133677 missense probably damaging 1.00
R0540:Rgs6 UTSW 12 83059804 nonsense probably null
R0630:Rgs6 UTSW 12 83047550 splice site probably benign
R1479:Rgs6 UTSW 12 83116244 missense probably damaging 1.00
R1533:Rgs6 UTSW 12 83091773 missense probably benign 0.00
R1545:Rgs6 UTSW 12 83116177 missense probably damaging 0.99
R2161:Rgs6 UTSW 12 83091804 missense probably damaging 1.00
R2421:Rgs6 UTSW 12 83116283 missense possibly damaging 0.93
R4089:Rgs6 UTSW 12 83063487 missense probably damaging 1.00
R4573:Rgs6 UTSW 12 83066015 missense probably damaging 1.00
R4821:Rgs6 UTSW 12 83067411 critical splice acceptor site probably null
R6228:Rgs6 UTSW 12 83065964 missense probably damaging 0.99
R7023:Rgs6 UTSW 12 83092104 intron probably benign
R7585:Rgs6 UTSW 12 83106870 missense probably damaging 1.00
R7610:Rgs6 UTSW 12 83091779 missense probably damaging 1.00
R7798:Rgs6 UTSW 12 83069519 missense probably benign 0.02
R8003:Rgs6 UTSW 12 82985370 missense probably damaging 0.99
R8081:Rgs6 UTSW 12 83047573 nonsense probably null
R8248:Rgs6 UTSW 12 83137704 intron probably benign
R8267:Rgs6 UTSW 12 82651895 missense probably benign
R8285:Rgs6 UTSW 12 83116175 missense probably benign 0.14
RF008:Rgs6 UTSW 12 83063449 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAACCGTCTCTAGCAGTGTC -3'
(R):5'- GGATTTCACTGTACACTTACCTGG -3'

Sequencing Primer
(F):5'- CGTCTCTAGCAGTGTCCAAATAG -3'
(R):5'- CTGGCACAGTTTCTACTG -3'
Posted On2020-01-23