Incidental Mutation 'R8011:Egflam'
ID616921
Institutional Source Beutler Lab
Gene Symbol Egflam
Ensembl Gene ENSMUSG00000042961
Gene NameEGF-like, fibronectin type III and laminin G domains
Synonymsnectican, pikachurin
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8011 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location7206120-7398395 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 7247044 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 547 (M547K)
Ref Sequence ENSEMBL: ENSMUSP00000094238 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058593] [ENSMUST00000096494] [ENSMUST00000160207]
Predicted Effect possibly damaging
Transcript: ENSMUST00000058593
AA Change: M547K

PolyPhen 2 Score 0.650 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000055599
Gene: ENSMUSG00000042961
AA Change: M547K

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
FN3 35 123 4.52e-9 SMART
FN3 142 225 1.89e-11 SMART
low complexity region 256 273 N/A INTRINSIC
EGF_like 346 381 4.28e1 SMART
LamG 407 543 1.04e-34 SMART
EGF 563 602 3.48e-5 SMART
LamG 633 767 1.55e-33 SMART
EGF 787 820 4.35e-6 SMART
LamG 852 988 1.47e-34 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000096494
AA Change: M547K

PolyPhen 2 Score 0.895 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000094238
Gene: ENSMUSG00000042961
AA Change: M547K

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
FN3 35 123 4.52e-9 SMART
FN3 142 225 1.89e-11 SMART
low complexity region 256 273 N/A INTRINSIC
EGF_like 346 381 4.28e1 SMART
LamG 407 543 1.04e-34 SMART
EGF 563 602 3.48e-5 SMART
LamG 633 767 1.55e-33 SMART
EGF 787 820 4.35e-6 SMART
LamG 860 996 1.47e-34 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000160207
Meta Mutation Damage Score 0.5512 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 100% (46/46)
MGI Phenotype PHENOTYPE: Homozygous null mutants are viable and fertile under normal conditions. They exhibit abnormal photoreceptor ribbon synapses, resulting in alteration in synaptic signal transmission and visual function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik C T 9: 124,293,899 E132K Het
Acss2 T C 2: 155,555,957 I313T possibly damaging Het
Akap13 G A 7: 75,730,465 R462H probably damaging Het
Ankrd27 T C 7: 35,616,881 V524A probably benign Het
Cacna1e T C 1: 154,465,822 I1209V probably benign Het
Cntn3 A T 6: 102,437,899 I29N possibly damaging Het
Col5a1 G A 2: 27,980,521 probably benign Het
Cttnbp2 G C 6: 18,426,093 A762G possibly damaging Het
Edc3 C A 9: 57,713,376 probably benign Het
Fgr T C 4: 132,998,479 Y400H probably damaging Het
Gaa C T 11: 119,272,936 P205S probably benign Het
Gm14139 A G 2: 150,192,346 S196G possibly damaging Het
Gpr6 T A 10: 41,070,915 T224S probably benign Het
Hes3 T C 4: 152,287,481 probably benign Het
Hydin T C 8: 110,583,909 F4079S probably damaging Het
Igf2bp2 A T 16: 22,076,099 I366N probably damaging Het
Kmt2c A G 5: 25,351,234 V1171A probably damaging Het
Kndc1 T A 7: 139,910,620 F346Y possibly damaging Het
Lpin2 G A 17: 71,230,375 G306R probably benign Het
Mok T C 12: 110,814,917 probably benign Het
Nolc1 T C 19: 46,081,584 V265A unknown Het
Ogfr GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG 2: 180,595,266 probably benign Het
Olfr1018 T G 2: 85,823,613 L214R possibly damaging Het
Olfr1106 A C 2: 87,048,846 L130R probably damaging Het
Olfr1195 G A 2: 88,683,193 Q180* probably null Het
Olfr1415 A G 1: 92,491,275 V160A possibly damaging Het
Parp14 G A 16: 35,856,634 T988I probably benign Het
Pdk1 A T 2: 71,875,452 Q81H probably benign Het
Plekha6 A G 1: 133,263,806 T38A probably benign Het
Pou2f1 A G 1: 165,894,903 probably null Het
Rgs6 A G 12: 83,116,292 D424G probably null Het
Rnf13 T G 3: 57,807,070 Y183* probably null Het
Ryr2 A T 13: 11,588,140 probably null Het
Serpinb7 T A 1: 107,434,757 S64T possibly damaging Het
Six2 T C 17: 85,687,672 E94G probably damaging Het
Slc44a5 A G 3: 154,247,810 I276M possibly damaging Het
Smco2 A G 6: 146,868,135 Y239C probably damaging Het
Ssx2ip T C 3: 146,422,911 S148P probably damaging Het
Tiam2 T C 17: 3,448,396 Y816H possibly damaging Het
Tnk2 C T 16: 32,668,365 R127C probably benign Het
Tpd52l1 T C 10: 31,332,917 N185S probably benign Het
Try5 T C 6: 41,313,487 D21G probably benign Het
Vmn2r20 A G 6: 123,396,410 V491A possibly damaging Het
Vps54 G T 11: 21,275,095 R197L probably damaging Het
Xkr5 G T 8: 18,948,720 Y27* probably null Het
Zfp626 T A 7: 27,818,715 C374S possibly damaging Het
Other mutations in Egflam
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01600:Egflam APN 15 7219764 missense probably damaging 1.00
IGL02352:Egflam APN 15 7234225 missense probably benign 0.01
IGL02359:Egflam APN 15 7234225 missense probably benign 0.01
IGL02389:Egflam APN 15 7250078 missense probably benign 0.01
IGL02400:Egflam APN 15 7247053 missense probably benign 0.00
IGL02530:Egflam APN 15 7222812 missense probably damaging 1.00
IGL02892:Egflam APN 15 7289796 missense probably benign
R0047:Egflam UTSW 15 7253430 missense possibly damaging 0.56
R0047:Egflam UTSW 15 7253430 missense possibly damaging 0.56
R0345:Egflam UTSW 15 7289994 splice site probably null
R0504:Egflam UTSW 15 7222758 missense probably damaging 1.00
R0532:Egflam UTSW 15 7234237 missense probably benign 0.19
R0573:Egflam UTSW 15 7242425 nonsense probably null
R0609:Egflam UTSW 15 7253523 missense possibly damaging 0.65
R0648:Egflam UTSW 15 7207709 missense probably damaging 1.00
R0653:Egflam UTSW 15 7250028 critical splice donor site probably null
R1099:Egflam UTSW 15 7252422 missense probably benign 0.00
R1711:Egflam UTSW 15 7289915 missense possibly damaging 0.85
R1842:Egflam UTSW 15 7303941 missense probably benign 0.00
R1964:Egflam UTSW 15 7247105 missense probably damaging 0.97
R2001:Egflam UTSW 15 7242567 missense probably benign 0.18
R2008:Egflam UTSW 15 7237804 missense possibly damaging 0.95
R2134:Egflam UTSW 15 7234279 missense probably damaging 0.97
R2852:Egflam UTSW 15 7219701 missense probably damaging 1.00
R2853:Egflam UTSW 15 7219701 missense probably damaging 1.00
R4257:Egflam UTSW 15 7254426 splice site probably null
R4346:Egflam UTSW 15 7234278 nonsense probably null
R4380:Egflam UTSW 15 7243869 missense possibly damaging 0.70
R4538:Egflam UTSW 15 7252437 missense probably damaging 1.00
R4746:Egflam UTSW 15 7224639 splice site probably null
R4909:Egflam UTSW 15 7219629 missense probably damaging 1.00
R5027:Egflam UTSW 15 7253644 missense probably benign 0.00
R5314:Egflam UTSW 15 7304012 missense probably damaging 1.00
R5439:Egflam UTSW 15 7224663 missense probably damaging 0.99
R5495:Egflam UTSW 15 7251241 missense probably damaging 1.00
R5626:Egflam UTSW 15 7251207 missense possibly damaging 0.89
R5931:Egflam UTSW 15 7243857 missense possibly damaging 0.49
R5977:Egflam UTSW 15 7318245 missense possibly damaging 0.94
R6258:Egflam UTSW 15 7234292 missense probably damaging 0.98
R6395:Egflam UTSW 15 7231695 missense probably damaging 1.00
R6497:Egflam UTSW 15 7251303 splice site probably null
R6736:Egflam UTSW 15 7219725 missense probably damaging 1.00
R7586:Egflam UTSW 15 7208601 missense probably damaging 1.00
R7764:Egflam UTSW 15 7318255 missense probably damaging 0.98
R7781:Egflam UTSW 15 7253746 missense probably null 0.94
R7842:Egflam UTSW 15 7251194 missense probably null 1.00
R8080:Egflam UTSW 15 7398080 missense probably benign 0.09
R8175:Egflam UTSW 15 7212152 missense probably damaging 1.00
R8300:Egflam UTSW 15 7254451 missense possibly damaging 0.77
R8553:Egflam UTSW 15 7207748 missense probably damaging 1.00
R8880:Egflam UTSW 15 7237768 missense probably damaging 0.98
X0024:Egflam UTSW 15 7304013 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CACAGAGCATTTGGCCTCAAG -3'
(R):5'- TACCCCACATCACAATCTGTTG -3'

Sequencing Primer
(F):5'- TGGCCTCAAGATGGATGTGACC -3'
(R):5'- TTCCGGACACCTCTGTAC -3'
Posted On2020-01-23