Incidental Mutation 'R8011:Tnk2'
ID616923
Institutional Source Beutler Lab
Gene Symbol Tnk2
Ensembl Gene ENSMUSG00000022791
Gene Nametyrosine kinase, non-receptor, 2
SynonymsACK1, Ack, P21cdc42Hs kinase, Pyk1, activated p21cdc42Hs kinase
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.388) question?
Stock #R8011 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location32643874-32683493 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 32668365 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 127 (R127C)
Ref Sequence ENSEMBL: ENSMUSP00000110777 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115120] [ENSMUST00000115121] [ENSMUST00000115122] [ENSMUST00000115123] [ENSMUST00000115124] [ENSMUST00000115125] [ENSMUST00000115126] [ENSMUST00000124585] [ENSMUST00000131238] [ENSMUST00000145627] [ENSMUST00000152361]
Predicted Effect probably benign
Transcript: ENSMUST00000115120
SMART Domains Protein: ENSMUSP00000110773
Gene: ENSMUSG00000022791

DomainStartEndE-ValueType
Pfam:GTPase_binding 1 24 1.1e-8 PFAM
low complexity region 247 264 N/A INTRINSIC
Pfam:Inhibitor_Mig-6 284 351 2.9e-30 PFAM
low complexity region 391 419 N/A INTRINSIC
Pfam:UBA 467 505 2.7e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115121
SMART Domains Protein: ENSMUSP00000110774
Gene: ENSMUSG00000022791

DomainStartEndE-ValueType
Pfam:GTPase_binding 1 24 4.5e-9 PFAM
low complexity region 27 34 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115122
Predicted Effect probably benign
Transcript: ENSMUST00000115123
AA Change: R127C

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000110776
Gene: ENSMUSG00000022791
AA Change: R127C

DomainStartEndE-ValueType
low complexity region 10 21 N/A INTRINSIC
Blast:TyrKc 43 79 3e-14 BLAST
TyrKc 126 385 1.44e-129 SMART
SH3 391 447 1.52e-7 SMART
low complexity region 737 754 N/A INTRINSIC
Pfam:Inhibitor_Mig-6 774 841 3e-30 PFAM
low complexity region 881 909 N/A INTRINSIC
Pfam:UBA 957 995 1.6e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115124
AA Change: R127C

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000110777
Gene: ENSMUSG00000022791
AA Change: R127C

DomainStartEndE-ValueType
low complexity region 10 21 N/A INTRINSIC
Blast:TyrKc 43 79 3e-14 BLAST
TyrKc 126 385 1.44e-129 SMART
SH3 391 447 1.52e-7 SMART
low complexity region 517 524 N/A INTRINSIC
low complexity region 752 769 N/A INTRINSIC
Pfam:Inhibitor_Mig-6 789 855 5.3e-29 PFAM
low complexity region 896 924 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115125
AA Change: R127C

PolyPhen 2 Score 0.198 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000110778
Gene: ENSMUSG00000022791
AA Change: R127C

DomainStartEndE-ValueType
low complexity region 10 21 N/A INTRINSIC
Blast:TyrKc 43 79 3e-14 BLAST
TyrKc 126 385 1.44e-129 SMART
SH3 391 447 1.52e-7 SMART
low complexity region 737 754 N/A INTRINSIC
Pfam:Inhibitor_Mig-6 774 841 7.2e-31 PFAM
low complexity region 881 909 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115126
AA Change: R127C

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000110779
Gene: ENSMUSG00000022791
AA Change: R127C

DomainStartEndE-ValueType
low complexity region 10 21 N/A INTRINSIC
Blast:TyrKc 43 79 3e-14 BLAST
TyrKc 126 385 1.44e-129 SMART
SH3 391 447 1.52e-7 SMART
low complexity region 517 524 N/A INTRINSIC
low complexity region 752 769 N/A INTRINSIC
Pfam:Inhibitor_Mig-6 789 856 2.9e-30 PFAM
low complexity region 896 924 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124585
Predicted Effect probably benign
Transcript: ENSMUST00000131238
SMART Domains Protein: ENSMUSP00000129382
Gene: ENSMUSG00000022791

DomainStartEndE-ValueType
Pfam:GTPase_binding 1 24 1e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000145627
Predicted Effect probably benign
Transcript: ENSMUST00000152361
SMART Domains Protein: ENSMUSP00000125905
Gene: ENSMUSG00000022791

DomainStartEndE-ValueType
SCOP:d1jo8a_ 8 38 2e-3 SMART
Pfam:GTPase_binding 39 106 2.8e-38 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 100% (46/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a tyrosine kinase that binds Cdc42Hs in its GTP-bound form and inhibits both the intrinsic and GTPase-activating protein (GAP)-stimulated GTPase activity of Cdc42Hs. This binding is mediated by a unique sequence of 47 amino acids C-terminal to an SH3 domain. The protein may be involved in a regulatory mechanism that sustains the GTP-bound active form of Cdc42Hs and which is directly linked to a tyrosine phosphorylation signal transduction pathway. Several alternatively spliced transcript variants have been identified from this gene, but the full-length nature of only two transcript variants has been determined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik C T 9: 124,293,899 E132K Het
Acss2 T C 2: 155,555,957 I313T possibly damaging Het
Akap13 G A 7: 75,730,465 R462H probably damaging Het
Ankrd27 T C 7: 35,616,881 V524A probably benign Het
Cacna1e T C 1: 154,465,822 I1209V probably benign Het
Cntn3 A T 6: 102,437,899 I29N possibly damaging Het
Col5a1 G A 2: 27,980,521 probably benign Het
Cttnbp2 G C 6: 18,426,093 A762G possibly damaging Het
Edc3 C A 9: 57,713,376 probably benign Het
Egflam A T 15: 7,247,044 M547K possibly damaging Het
Fgr T C 4: 132,998,479 Y400H probably damaging Het
Gaa C T 11: 119,272,936 P205S probably benign Het
Gm14139 A G 2: 150,192,346 S196G possibly damaging Het
Gpr6 T A 10: 41,070,915 T224S probably benign Het
Hes3 T C 4: 152,287,481 probably benign Het
Hydin T C 8: 110,583,909 F4079S probably damaging Het
Igf2bp2 A T 16: 22,076,099 I366N probably damaging Het
Kmt2c A G 5: 25,351,234 V1171A probably damaging Het
Kndc1 T A 7: 139,910,620 F346Y possibly damaging Het
Lpin2 G A 17: 71,230,375 G306R probably benign Het
Mok T C 12: 110,814,917 probably benign Het
Nolc1 T C 19: 46,081,584 V265A unknown Het
Ogfr GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG 2: 180,595,266 probably benign Het
Olfr1018 T G 2: 85,823,613 L214R possibly damaging Het
Olfr1106 A C 2: 87,048,846 L130R probably damaging Het
Olfr1195 G A 2: 88,683,193 Q180* probably null Het
Olfr1415 A G 1: 92,491,275 V160A possibly damaging Het
Parp14 G A 16: 35,856,634 T988I probably benign Het
Pdk1 A T 2: 71,875,452 Q81H probably benign Het
Plekha6 A G 1: 133,263,806 T38A probably benign Het
Pou2f1 A G 1: 165,894,903 probably null Het
Rgs6 A G 12: 83,116,292 D424G probably null Het
Rnf13 T G 3: 57,807,070 Y183* probably null Het
Ryr2 A T 13: 11,588,140 probably null Het
Serpinb7 T A 1: 107,434,757 S64T possibly damaging Het
Six2 T C 17: 85,687,672 E94G probably damaging Het
Slc44a5 A G 3: 154,247,810 I276M possibly damaging Het
Smco2 A G 6: 146,868,135 Y239C probably damaging Het
Ssx2ip T C 3: 146,422,911 S148P probably damaging Het
Tiam2 T C 17: 3,448,396 Y816H possibly damaging Het
Tpd52l1 T C 10: 31,332,917 N185S probably benign Het
Try5 T C 6: 41,313,487 D21G probably benign Het
Vmn2r20 A G 6: 123,396,410 V491A possibly damaging Het
Vps54 G T 11: 21,275,095 R197L probably damaging Het
Xkr5 G T 8: 18,948,720 Y27* probably null Het
Zfp626 T A 7: 27,818,715 C374S possibly damaging Het
Other mutations in Tnk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01419:Tnk2 APN 16 32680680 missense probably damaging 0.99
IGL02212:Tnk2 APN 16 32680142 missense probably damaging 0.97
IGL02445:Tnk2 APN 16 32675590 missense probably benign 0.00
junior UTSW 16 32680085 missense probably benign
Rookie UTSW 16 32679785 missense probably damaging 1.00
IGL02799:Tnk2 UTSW 16 32665881 splice site probably benign
R0310:Tnk2 UTSW 16 32680590 missense probably benign
R0989:Tnk2 UTSW 16 32680358 missense probably damaging 1.00
R1556:Tnk2 UTSW 16 32670919 critical splice donor site probably null
R1851:Tnk2 UTSW 16 32679462 missense probably damaging 1.00
R1854:Tnk2 UTSW 16 32680142 missense probably damaging 0.97
R1938:Tnk2 UTSW 16 32663742 start gained probably benign
R2137:Tnk2 UTSW 16 32670802 splice site probably null
R2189:Tnk2 UTSW 16 32671421 missense probably damaging 1.00
R3772:Tnk2 UTSW 16 32679822 missense probably damaging 1.00
R4037:Tnk2 UTSW 16 32670796 missense probably damaging 1.00
R4413:Tnk2 UTSW 16 32669501 missense probably damaging 1.00
R4751:Tnk2 UTSW 16 32679857 missense probably damaging 1.00
R4878:Tnk2 UTSW 16 32679630 missense probably damaging 1.00
R4983:Tnk2 UTSW 16 32680465 missense probably damaging 1.00
R5063:Tnk2 UTSW 16 32670850 missense probably damaging 1.00
R5541:Tnk2 UTSW 16 32669523 missense probably benign 0.07
R5759:Tnk2 UTSW 16 32680664 missense probably benign
R5888:Tnk2 UTSW 16 32671367 missense probably damaging 1.00
R6142:Tnk2 UTSW 16 32670099 missense probably damaging 1.00
R6372:Tnk2 UTSW 16 32679785 missense probably damaging 1.00
R6717:Tnk2 UTSW 16 32670869 missense probably damaging 1.00
R6939:Tnk2 UTSW 16 32663878 missense probably damaging 1.00
R7157:Tnk2 UTSW 16 32681168 missense probably damaging 1.00
R7292:Tnk2 UTSW 16 32680800 missense probably benign
R7362:Tnk2 UTSW 16 32675520 critical splice acceptor site probably null
R7477:Tnk2 UTSW 16 32677891 splice site probably null
R7558:Tnk2 UTSW 16 32680085 missense probably benign
R7665:Tnk2 UTSW 16 32680526 missense probably damaging 1.00
R7731:Tnk2 UTSW 16 32670134 missense possibly damaging 0.69
R7867:Tnk2 UTSW 16 32681235 missense probably damaging 0.99
R8167:Tnk2 UTSW 16 32680262 missense probably damaging 1.00
R8738:Tnk2 UTSW 16 32665900 missense probably damaging 1.00
X0063:Tnk2 UTSW 16 32670850 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTGTCTGAGGCTTACCAGTAG -3'
(R):5'- AACCTGAACATGGCTCAAAAGG -3'

Sequencing Primer
(F):5'- ACTGAGTGCCTCTGGGG -3'
(R):5'- GTGAGTACTTTCACAACTGTCCCTAG -3'
Posted On2020-01-23