Incidental Mutation 'R8011:Parp14'
ID616924
Institutional Source Beutler Lab
Gene Symbol Parp14
Ensembl Gene ENSMUSG00000034422
Gene Namepoly (ADP-ribose) polymerase family, member 14
Synonymscollaborator of Stat6, 1600029O10Rik, CoaSt6
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.443) question?
Stock #R8011 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location35832874-35871544 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 35856634 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 988 (T988I)
Ref Sequence ENSEMBL: ENSMUSP00000037657 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042665]
PDB Structure Solution structure of WWE domain in Parp14 protein [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000042665
AA Change: T988I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000037657
Gene: ENSMUSG00000034422
AA Change: T988I

DomainStartEndE-ValueType
low complexity region 38 49 N/A INTRINSIC
low complexity region 93 115 N/A INTRINSIC
RRM 228 297 4.71e-2 SMART
coiled coil region 443 468 N/A INTRINSIC
Blast:A1pp 693 746 6e-6 BLAST
low complexity region 771 795 N/A INTRINSIC
A1pp 814 948 7.62e-41 SMART
A1pp 1026 1160 5.88e-24 SMART
A1pp 1239 1358 6.82e-20 SMART
PDB:1X4R|A 1532 1619 9e-53 PDB
Pfam:PARP 1632 1817 2.5e-29 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 100% (46/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the poly(ADP-ribose) polymerase (PARP) protein family. The encoded anti-apoptotic protein may regulate aerobic glycolysis and promote survival of cancer cells. Increased expression of this gene has been reported in a variety of tumor types. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit altered B cell subsets and inability to respond to the apoptosis protective affects of IL4. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik C T 9: 124,293,899 E132K Het
Acss2 T C 2: 155,555,957 I313T possibly damaging Het
Akap13 G A 7: 75,730,465 R462H probably damaging Het
Ankrd27 T C 7: 35,616,881 V524A probably benign Het
Cacna1e T C 1: 154,465,822 I1209V probably benign Het
Cntn3 A T 6: 102,437,899 I29N possibly damaging Het
Col5a1 G A 2: 27,980,521 probably benign Het
Cttnbp2 G C 6: 18,426,093 A762G possibly damaging Het
Edc3 C A 9: 57,713,376 probably benign Het
Egflam A T 15: 7,247,044 M547K possibly damaging Het
Fgr T C 4: 132,998,479 Y400H probably damaging Het
Gaa C T 11: 119,272,936 P205S probably benign Het
Gm14139 A G 2: 150,192,346 S196G possibly damaging Het
Gpr6 T A 10: 41,070,915 T224S probably benign Het
Hes3 T C 4: 152,287,481 probably benign Het
Hydin T C 8: 110,583,909 F4079S probably damaging Het
Igf2bp2 A T 16: 22,076,099 I366N probably damaging Het
Kmt2c A G 5: 25,351,234 V1171A probably damaging Het
Kndc1 T A 7: 139,910,620 F346Y possibly damaging Het
Lpin2 G A 17: 71,230,375 G306R probably benign Het
Mok T C 12: 110,814,917 probably benign Het
Nolc1 T C 19: 46,081,584 V265A unknown Het
Ogfr GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG 2: 180,595,266 probably benign Het
Olfr1018 T G 2: 85,823,613 L214R possibly damaging Het
Olfr1106 A C 2: 87,048,846 L130R probably damaging Het
Olfr1195 G A 2: 88,683,193 Q180* probably null Het
Olfr1415 A G 1: 92,491,275 V160A possibly damaging Het
Pdk1 A T 2: 71,875,452 Q81H probably benign Het
Plekha6 A G 1: 133,263,806 T38A probably benign Het
Pou2f1 A G 1: 165,894,903 probably null Het
Rgs6 A G 12: 83,116,292 D424G probably null Het
Rnf13 T G 3: 57,807,070 Y183* probably null Het
Ryr2 A T 13: 11,588,140 probably null Het
Serpinb7 T A 1: 107,434,757 S64T possibly damaging Het
Six2 T C 17: 85,687,672 E94G probably damaging Het
Slc44a5 A G 3: 154,247,810 I276M possibly damaging Het
Smco2 A G 6: 146,868,135 Y239C probably damaging Het
Ssx2ip T C 3: 146,422,911 S148P probably damaging Het
Tiam2 T C 17: 3,448,396 Y816H possibly damaging Het
Tnk2 C T 16: 32,668,365 R127C probably benign Het
Tpd52l1 T C 10: 31,332,917 N185S probably benign Het
Try5 T C 6: 41,313,487 D21G probably benign Het
Vmn2r20 A G 6: 123,396,410 V491A possibly damaging Het
Vps54 G T 11: 21,275,095 R197L probably damaging Het
Xkr5 G T 8: 18,948,720 Y27* probably null Het
Zfp626 T A 7: 27,818,715 C374S possibly damaging Het
Other mutations in Parp14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00337:Parp14 APN 16 35841075 missense probably benign 0.00
IGL00497:Parp14 APN 16 35834836 missense probably damaging 1.00
IGL00754:Parp14 APN 16 35839371 missense probably benign 0.15
IGL00960:Parp14 APN 16 35841219 missense probably benign 0.20
IGL01321:Parp14 APN 16 35856559 missense probably benign
IGL01397:Parp14 APN 16 35858728 missense probably benign 0.19
IGL01591:Parp14 APN 16 35858507 missense possibly damaging 0.71
IGL01728:Parp14 APN 16 35857435 missense probably damaging 1.00
IGL01734:Parp14 APN 16 35858600 missense probably benign 0.00
IGL02156:Parp14 APN 16 35858597 missense probably benign 0.13
IGL02951:Parp14 APN 16 35858533 missense probably benign 0.06
IGL03067:Parp14 APN 16 35856508 missense probably benign 0.10
IGL03135:Parp14 APN 16 35858011 missense probably damaging 1.00
IGL03141:Parp14 APN 16 35839293 missense probably benign 0.00
IGL03146:Parp14 APN 16 35858453 nonsense probably null
IGL03333:Parp14 APN 16 35841430 missense probably benign 0.08
IGL03391:Parp14 APN 16 35858270 missense probably benign
thurston UTSW 16 35844415 splice site probably benign
PIT4585001:Parp14 UTSW 16 35858605 missense probably benign 0.03
R0306:Parp14 UTSW 16 35856574 missense probably benign
R0506:Parp14 UTSW 16 35841409 missense possibly damaging 0.70
R0586:Parp14 UTSW 16 35841012 missense probably benign 0.00
R0606:Parp14 UTSW 16 35856760 missense probably benign 0.09
R0612:Parp14 UTSW 16 35856760 missense probably benign 0.09
R0699:Parp14 UTSW 16 35860585 missense probably damaging 1.00
R0786:Parp14 UTSW 16 35840802 missense possibly damaging 0.86
R0883:Parp14 UTSW 16 35858518 missense probably benign 0.03
R0900:Parp14 UTSW 16 35856760 missense probably benign 0.09
R1087:Parp14 UTSW 16 35858288 missense probably damaging 1.00
R1104:Parp14 UTSW 16 35844415 splice site probably benign
R1120:Parp14 UTSW 16 35856760 missense probably benign 0.09
R1134:Parp14 UTSW 16 35834902 missense probably damaging 1.00
R1153:Parp14 UTSW 16 35857671 missense possibly damaging 0.49
R1159:Parp14 UTSW 16 35856760 missense probably benign 0.09
R1160:Parp14 UTSW 16 35856760 missense probably benign 0.09
R1237:Parp14 UTSW 16 35856760 missense probably benign 0.09
R1238:Parp14 UTSW 16 35856760 missense probably benign 0.09
R1239:Parp14 UTSW 16 35856760 missense probably benign 0.09
R1423:Parp14 UTSW 16 35856760 missense probably benign 0.09
R1511:Parp14 UTSW 16 35857224 missense probably benign 0.00
R1518:Parp14 UTSW 16 35856638 missense possibly damaging 0.79
R1619:Parp14 UTSW 16 35856760 missense probably benign 0.09
R1707:Parp14 UTSW 16 35857849 missense probably damaging 1.00
R1792:Parp14 UTSW 16 35856760 missense probably benign 0.09
R1831:Parp14 UTSW 16 35858588 missense possibly damaging 0.77
R1840:Parp14 UTSW 16 35863449 missense probably damaging 1.00
R1889:Parp14 UTSW 16 35856760 missense probably benign 0.09
R1902:Parp14 UTSW 16 35853518 critical splice donor site probably null
R1943:Parp14 UTSW 16 35836129 missense probably damaging 1.00
R1954:Parp14 UTSW 16 35858301 missense probably benign 0.08
R2115:Parp14 UTSW 16 35858534 missense probably benign 0.16
R2216:Parp14 UTSW 16 35857205 missense probably benign 0.00
R2519:Parp14 UTSW 16 35858203 missense possibly damaging 0.95
R3851:Parp14 UTSW 16 35853748 missense possibly damaging 0.92
R4052:Parp14 UTSW 16 35858401 missense probably benign 0.05
R4671:Parp14 UTSW 16 35858321 missense probably benign 0.00
R4867:Parp14 UTSW 16 35857327 missense probably benign 0.01
R4941:Parp14 UTSW 16 35846033 missense probably benign
R4992:Parp14 UTSW 16 35841142 missense probably benign 0.05
R5055:Parp14 UTSW 16 35844363 missense probably benign 0.00
R5073:Parp14 UTSW 16 35834707 missense probably damaging 0.99
R5170:Parp14 UTSW 16 35857279 missense probably benign 0.21
R5422:Parp14 UTSW 16 35866175 missense probably benign 0.01
R5543:Parp14 UTSW 16 35834767 missense probably benign 0.00
R5549:Parp14 UTSW 16 35841135 missense probably benign 0.00
R5553:Parp14 UTSW 16 35856936 missense probably benign 0.01
R5691:Parp14 UTSW 16 35863539 missense probably benign 0.12
R5774:Parp14 UTSW 16 35858410 missense probably damaging 1.00
R5855:Parp14 UTSW 16 35840927 nonsense probably null
R5942:Parp14 UTSW 16 35839367 missense probably damaging 0.98
R5990:Parp14 UTSW 16 35841457 missense probably benign 0.14
R5991:Parp14 UTSW 16 35841457 missense probably benign 0.14
R6018:Parp14 UTSW 16 35841457 missense probably benign 0.14
R6022:Parp14 UTSW 16 35841457 missense probably benign 0.14
R6075:Parp14 UTSW 16 35857019 missense probably damaging 0.99
R6395:Parp14 UTSW 16 35856548 missense probably benign 0.00
R6525:Parp14 UTSW 16 35860441 missense probably benign 0.05
R6683:Parp14 UTSW 16 35834677 missense probably damaging 1.00
R7525:Parp14 UTSW 16 35857491 missense probably benign 0.00
R8192:Parp14 UTSW 16 35871214 missense probably benign 0.01
R8367:Parp14 UTSW 16 35857754 missense probably benign 0.36
R8526:Parp14 UTSW 16 35840937 missense possibly damaging 0.87
R8751:Parp14 UTSW 16 35856811 missense probably benign 0.32
R8962:Parp14 UTSW 16 35856817 missense probably damaging 1.00
X0026:Parp14 UTSW 16 35857157 nonsense probably null
X0060:Parp14 UTSW 16 35834707 missense probably damaging 0.99
Z1088:Parp14 UTSW 16 35841586 missense probably damaging 1.00
Z1177:Parp14 UTSW 16 35845338 missense probably damaging 1.00
Z1177:Parp14 UTSW 16 35871203 missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- AACAGGGACATTGCCTTACCG -3'
(R):5'- GGTTAGACAAAGCCTCAGTTTAGC -3'

Sequencing Primer
(F):5'- GGACATTGCCTTACCGTAGCATTC -3'
(R):5'- ATAGCCATGCCAGCGGTCAG -3'
Posted On2020-01-23