Incidental Mutation 'R8011:Six2'
ID616927
Institutional Source Beutler Lab
Gene Symbol Six2
Ensembl Gene ENSMUSG00000024134
Gene Namesine oculis-related homeobox 2
Synonyms
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8011 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location85684277-85688274 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 85687672 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 94 (E94G)
Ref Sequence ENSEMBL: ENSMUSP00000024947 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024947] [ENSMUST00000163568]
Predicted Effect probably damaging
Transcript: ENSMUST00000024947
AA Change: E94G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000024947
Gene: ENSMUSG00000024134
AA Change: E94G

DomainStartEndE-ValueType
HOX 125 186 8.72e-18 SMART
low complexity region 228 269 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000163568
AA Change: E94G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125871
Gene: ENSMUSG00000024134
AA Change: E94G

DomainStartEndE-ValueType
Pfam:SIX1_SD 9 119 1.5e-52 PFAM
HOX 125 186 8.72e-18 SMART
low complexity region 228 269 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the vertebrate gene family which encode proteins homologous to the Drosophila 'sine oculis' homeobox protein. The encoded protein is a transcription factor which, like other members of this gene family, may be involved in limb or eye development. [provided by RefSeq, Dec 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene die shortly after birth and exhibit abnormal kidney development. Abnormalities include small kidney, lack of ureteric bud branches throughout the kidney, increased apoptosis and premature and arrested nephron development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik C T 9: 124,293,899 E132K Het
Acss2 T C 2: 155,555,957 I313T possibly damaging Het
Akap13 G A 7: 75,730,465 R462H probably damaging Het
Ankrd27 T C 7: 35,616,881 V524A probably benign Het
Cacna1e T C 1: 154,465,822 I1209V probably benign Het
Cntn3 A T 6: 102,437,899 I29N possibly damaging Het
Cttnbp2 G C 6: 18,426,093 A762G possibly damaging Het
Egflam A T 15: 7,247,044 M547K possibly damaging Het
Fgr T C 4: 132,998,479 Y400H probably damaging Het
Gaa C T 11: 119,272,936 P205S probably benign Het
Gm14139 A G 2: 150,192,346 S196G possibly damaging Het
Gpr6 T A 10: 41,070,915 T224S probably benign Het
Hydin T C 8: 110,583,909 F4079S probably damaging Het
Igf2bp2 A T 16: 22,076,099 I366N probably damaging Het
Kmt2c A G 5: 25,351,234 V1171A probably damaging Het
Kndc1 T A 7: 139,910,620 F346Y possibly damaging Het
Lpin2 G A 17: 71,230,375 G306R probably benign Het
Nolc1 T C 19: 46,081,584 V265A unknown Het
Ogfr GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG 2: 180,595,266 probably benign Het
Olfr1018 T G 2: 85,823,613 L214R possibly damaging Het
Olfr1106 A C 2: 87,048,846 L130R probably damaging Het
Olfr1195 G A 2: 88,683,193 Q180* probably null Het
Olfr1415 A G 1: 92,491,275 V160A possibly damaging Het
Parp14 G A 16: 35,856,634 T988I probably benign Het
Pdk1 A T 2: 71,875,452 Q81H probably benign Het
Plekha6 A G 1: 133,263,806 T38A probably benign Het
Pou2f1 A G 1: 165,894,903 probably null Het
Rgs6 A G 12: 83,116,292 D424G probably null Het
Rnf13 T G 3: 57,807,070 Y183* probably null Het
Ryr2 A T 13: 11,588,140 probably null Het
Serpinb7 T A 1: 107,434,757 S64T possibly damaging Het
Slc44a5 A G 3: 154,247,810 I276M possibly damaging Het
Smco2 A G 6: 146,868,135 Y239C probably damaging Het
Ssx2ip T C 3: 146,422,911 S148P probably damaging Het
Tiam2 T C 17: 3,448,396 Y816H possibly damaging Het
Tnk2 C T 16: 32,668,365 R127C probably benign Het
Tpd52l1 T C 10: 31,332,917 N185S probably benign Het
Try5 T C 6: 41,313,487 D21G probably benign Het
Vmn2r20 A G 6: 123,396,410 V491A possibly damaging Het
Vps54 G T 11: 21,275,095 R197L probably damaging Het
Xkr5 G T 8: 18,948,720 Y27* probably null Het
Zfp626 T A 7: 27,818,715 C374S possibly damaging Het
Other mutations in Six2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00909:Six2 APN 17 85687891 missense probably damaging 1.00
IGL02452:Six2 APN 17 85685378 missense possibly damaging 0.91
IGL02468:Six2 APN 17 85685503 missense possibly damaging 0.80
PIT4449001:Six2 UTSW 17 85685478 missense probably benign 0.00
PIT4812001:Six2 UTSW 17 85685301 missense possibly damaging 0.92
R2073:Six2 UTSW 17 85687505 missense probably damaging 1.00
R2075:Six2 UTSW 17 85687505 missense probably damaging 1.00
R2915:Six2 UTSW 17 85685188 missense probably damaging 1.00
R3830:Six2 UTSW 17 85685187 missense probably damaging 1.00
R5834:Six2 UTSW 17 85687664 missense probably damaging 0.96
R7555:Six2 UTSW 17 85687707 missense probably damaging 1.00
R7723:Six2 UTSW 17 85687675 missense probably benign 0.06
Z1176:Six2 UTSW 17 85685456 missense probably benign 0.26
Z1177:Six2 UTSW 17 85687625 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CTTGAACCAGTTGCTGACTTGC -3'
(R):5'- GGATCGTTGTGACTCAGGAG -3'

Sequencing Primer
(F):5'- GCTTCTCTCGTGGCGAC -3'
(R):5'- CTTCACGCAGGAGCAAGTG -3'
Posted On2020-01-23