Incidental Mutation 'R8012:Dhcr24'
ID616939
Institutional Source Beutler Lab
Gene Symbol Dhcr24
Ensembl Gene ENSMUSG00000034926
Gene Name24-dehydrocholesterol reductase
Synonyms2310076D10Rik, seladin-1, 5830417J06Rik, 3-beta-hydroxysterol delta-24 reductase
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.906) question?
Stock #R8012 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location106561038-106589113 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 106586656 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 481 (F481S)
Ref Sequence ENSEMBL: ENSMUSP00000038063 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047973] [ENSMUST00000067387] [ENSMUST00000106788] [ENSMUST00000126324] [ENSMUST00000189032]
Predicted Effect probably damaging
Transcript: ENSMUST00000047973
AA Change: F481S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000038063
Gene: ENSMUSG00000034926
AA Change: F481S

DomainStartEndE-ValueType
Pfam:FAD_binding_4 71 203 2e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000067387
SMART Domains Protein: ENSMUSP00000066732
Gene: ENSMUSG00000054362

DomainStartEndE-ValueType
Pfam:SHIPPO-rpt 63 83 1.3e-2 PFAM
Pfam:SHIPPO-rpt 119 152 3.5e-4 PFAM
low complexity region 157 173 N/A INTRINSIC
Pfam:SHIPPO-rpt 205 240 4.3e-3 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106788
SMART Domains Protein: ENSMUSP00000102400
Gene: ENSMUSG00000054362

DomainStartEndE-ValueType
internal_repeat_1 62 146 2.56e-5 PROSPERO
low complexity region 157 173 N/A INTRINSIC
internal_repeat_1 204 279 2.56e-5 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000126324
Predicted Effect probably benign
Transcript: ENSMUST00000189032
SMART Domains Protein: ENSMUSP00000139868
Gene: ENSMUSG00000054362

DomainStartEndE-ValueType
Pfam:SHIPPO-rpt 63 83 1.3e-2 PFAM
Pfam:SHIPPO-rpt 119 152 3.5e-4 PFAM
low complexity region 157 173 N/A INTRINSIC
Pfam:SHIPPO-rpt 205 240 4.3e-3 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a flavin adenine dinucleotide (FAD)-dependent oxidoreductase which catalyzes the reduction of the delta-24 double bond of sterol intermediates during cholesterol biosynthesis. The protein contains a leader sequence that directs it to the endoplasmic reticulum membrane. Missense mutations in this gene have been associated with desmosterolosis. Also, reduced expression of the gene occurs in the temporal cortex of Alzheimer disease patients and overexpression has been observed in adrenal gland cancer cells. [provided by RefSeq, Jul 2008]
PHENOTYPE: In spite of having almost no plasma or tissue cholesterol, homozygous mutant mice are largely viable and display a mild growth phenotype. Inactivation did impair prenatal viability as well as infertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930021J03Rik A G 19: 29,718,134 S1320P possibly damaging Het
Adam19 A G 11: 46,065,046 E73G possibly damaging Het
Akap13 G A 7: 75,730,465 R462H probably damaging Het
Alas1 A T 9: 106,246,763 N65K probably benign Het
Amigo1 T A 3: 108,188,642 S486T probably damaging Het
Arid1a A G 4: 133,692,863 L591S unknown Het
Asic1 T C 15: 99,696,651 V326A possibly damaging Het
Aspm A G 1: 139,457,464 N282S probably benign Het
Atad5 A G 11: 80,094,240 D51G probably damaging Het
Cabp5 A T 7: 13,407,781 probably null Het
Cdca2 A G 14: 67,677,372 C813R probably benign Het
Chpf2 A T 5: 24,590,345 R289W probably damaging Het
Csf1r A T 18: 61,117,064 N367I possibly damaging Het
Cyp2c66 T C 19: 39,183,925 F428S probably damaging Het
Dgkb A T 12: 38,139,486 N296I probably benign Het
Diaph3 T C 14: 87,037,522 Y166C probably benign Het
Dnah7b A T 1: 46,243,365 Q2886L probably damaging Het
Dock6 A T 9: 21,846,511 V99E probably benign Het
F830045P16Rik T C 2: 129,474,432 D119G possibly damaging Het
Fasn A T 11: 120,811,602 L1773Q probably damaging Het
Filip1 A T 9: 79,817,959 V1126E probably damaging Het
Fnta T C 8: 25,999,507 I359V probably benign Het
Gm13178 T A 4: 144,703,402 D339V possibly damaging Het
Hoxc10 T C 15: 102,967,467 S204P probably benign Het
Kif26b T C 1: 178,916,250 C1304R probably benign Het
Lamc1 T C 1: 153,221,612 E1562G probably benign Het
Lrguk A G 6: 34,056,103 N235D probably benign Het
Ly6g6f T C 17: 35,081,084 R263G possibly damaging Het
Mcrs1 C A 15: 99,249,885 S47I probably damaging Het
Mx1 T A 16: 97,457,372 I42F probably damaging Het
Nrp2 C T 1: 62,745,408 R239C probably damaging Het
Nup188 T A 2: 30,337,265 C1235S possibly damaging Het
Obsl1 T A 1: 75,492,673 H1208L probably benign Het
Pcmt1 T C 10: 7,640,763 D175G probably benign Het
Pcolce T C 5: 137,605,195 K459E probably benign Het
Pudp T G 18: 50,568,239 H141P possibly damaging Het
Rock2 T C 12: 16,942,742 Y171H probably damaging Het
Rwdd1 A C 10: 34,009,202 probably benign Het
Sbno1 A G 5: 124,384,502 V1085A probably benign Het
Tie1 A G 4: 118,486,481 L88P possibly damaging Het
Tmem131 T C 1: 36,807,964 D1351G probably damaging Het
Tph1 A T 7: 46,656,879 D219E probably damaging Het
Wdr86 A G 5: 24,730,179 probably null Het
Other mutations in Dhcr24
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01305:Dhcr24 APN 4 106572278 missense possibly damaging 0.50
IGL01548:Dhcr24 APN 4 106573871 nonsense probably null
IGL02110:Dhcr24 APN 4 106573801 missense probably damaging 1.00
IGL02256:Dhcr24 APN 4 106572320 missense probably damaging 0.98
IGL02748:Dhcr24 APN 4 106564392 splice site probably benign
IGL02926:Dhcr24 APN 4 106586355 missense probably damaging 0.98
ANU22:Dhcr24 UTSW 4 106572278 missense possibly damaging 0.50
R0423:Dhcr24 UTSW 4 106586536 unclassified probably benign
R1632:Dhcr24 UTSW 4 106585951 missense probably benign
R1771:Dhcr24 UTSW 4 106578253 missense probably benign 0.00
R2138:Dhcr24 UTSW 4 106572302 nonsense probably null
R2139:Dhcr24 UTSW 4 106572302 nonsense probably null
R2420:Dhcr24 UTSW 4 106561094 start gained probably benign
R2422:Dhcr24 UTSW 4 106561094 start gained probably benign
R2570:Dhcr24 UTSW 4 106585832 missense probably benign 0.00
R3176:Dhcr24 UTSW 4 106561239 missense probably benign 0.16
R3276:Dhcr24 UTSW 4 106561239 missense probably benign 0.16
R3842:Dhcr24 UTSW 4 106585805 missense probably damaging 1.00
R3852:Dhcr24 UTSW 4 106573873 missense probably benign 0.02
R4037:Dhcr24 UTSW 4 106573878 missense probably benign 0.01
R4038:Dhcr24 UTSW 4 106573878 missense probably benign 0.01
R4039:Dhcr24 UTSW 4 106573878 missense probably benign 0.01
R5831:Dhcr24 UTSW 4 106564414 missense probably benign 0.03
R7285:Dhcr24 UTSW 4 106571519 critical splice donor site probably null
R7821:Dhcr24 UTSW 4 106571436 missense possibly damaging 0.61
X0057:Dhcr24 UTSW 4 106586345 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGCCACGTGTGAAGCACTTC -3'
(R):5'- GTTTCTTTTCTGAGACCTGGGAAAG -3'

Sequencing Primer
(F):5'- TGTGAAGCACTTCGAGGC -3'
(R):5'- TTTTCTGAGACCTGGGAAAGCAGAG -3'
Posted On2020-01-23