Incidental Mutation 'R8012:Dhcr24'
ID 616939
Institutional Source Beutler Lab
Gene Symbol Dhcr24
Ensembl Gene ENSMUSG00000034926
Gene Name 24-dehydrocholesterol reductase
Synonyms 5830417J06Rik, seladin-1, 2310076D10Rik, 3-beta-hydroxysterol delta-24 reductase
MMRRC Submission 046052-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.872) question?
Stock # R8012 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 106418279-106446310 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 106443853 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Serine at position 481 (F481S)
Ref Sequence ENSEMBL: ENSMUSP00000038063 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047973] [ENSMUST00000067387] [ENSMUST00000106788] [ENSMUST00000126324] [ENSMUST00000189032]
AlphaFold Q8VCH6
Predicted Effect probably damaging
Transcript: ENSMUST00000047973
AA Change: F481S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000038063
Gene: ENSMUSG00000034926
AA Change: F481S

DomainStartEndE-ValueType
Pfam:FAD_binding_4 71 203 2e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000067387
SMART Domains Protein: ENSMUSP00000066732
Gene: ENSMUSG00000054362

DomainStartEndE-ValueType
Pfam:SHIPPO-rpt 63 83 1.3e-2 PFAM
Pfam:SHIPPO-rpt 119 152 3.5e-4 PFAM
low complexity region 157 173 N/A INTRINSIC
Pfam:SHIPPO-rpt 205 240 4.3e-3 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106788
SMART Domains Protein: ENSMUSP00000102400
Gene: ENSMUSG00000054362

DomainStartEndE-ValueType
internal_repeat_1 62 146 2.56e-5 PROSPERO
low complexity region 157 173 N/A INTRINSIC
internal_repeat_1 204 279 2.56e-5 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000126324
Predicted Effect probably benign
Transcript: ENSMUST00000189032
SMART Domains Protein: ENSMUSP00000139868
Gene: ENSMUSG00000054362

DomainStartEndE-ValueType
Pfam:SHIPPO-rpt 63 83 1.3e-2 PFAM
Pfam:SHIPPO-rpt 119 152 3.5e-4 PFAM
low complexity region 157 173 N/A INTRINSIC
Pfam:SHIPPO-rpt 205 240 4.3e-3 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a flavin adenine dinucleotide (FAD)-dependent oxidoreductase which catalyzes the reduction of the delta-24 double bond of sterol intermediates during cholesterol biosynthesis. The protein contains a leader sequence that directs it to the endoplasmic reticulum membrane. Missense mutations in this gene have been associated with desmosterolosis. Also, reduced expression of the gene occurs in the temporal cortex of Alzheimer disease patients and overexpression has been observed in adrenal gland cancer cells. [provided by RefSeq, Jul 2008]
PHENOTYPE: In spite of having almost no plasma or tissue cholesterol, homozygous mutant mice are largely viable and display a mild growth phenotype. Inactivation did impair prenatal viability as well as infertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AAdacl4fm3 T A 4: 144,429,972 (GRCm39) D339V possibly damaging Het
Adam19 A G 11: 45,955,873 (GRCm39) E73G possibly damaging Het
Akap13 G A 7: 75,380,213 (GRCm39) R462H probably damaging Het
Alas1 A T 9: 106,123,962 (GRCm39) N65K probably benign Het
Amigo1 T A 3: 108,095,958 (GRCm39) S486T probably damaging Het
Arid1a A G 4: 133,420,174 (GRCm39) L591S unknown Het
Asic1 T C 15: 99,594,532 (GRCm39) V326A possibly damaging Het
Aspm A G 1: 139,385,202 (GRCm39) N282S probably benign Het
Atad5 A G 11: 79,985,066 (GRCm39) D51G probably damaging Het
Brd10 A G 19: 29,695,534 (GRCm39) S1320P possibly damaging Het
Cabp5 A T 7: 13,141,706 (GRCm39) probably null Het
Cdca2 A G 14: 67,914,821 (GRCm39) C813R probably benign Het
Chpf2 A T 5: 24,795,343 (GRCm39) R289W probably damaging Het
Csf1r A T 18: 61,250,136 (GRCm39) N367I possibly damaging Het
Cyp2c66 T C 19: 39,172,369 (GRCm39) F428S probably damaging Het
Dgkb A T 12: 38,189,485 (GRCm39) N296I probably benign Het
Diaph3 T C 14: 87,274,958 (GRCm39) Y166C probably benign Het
Dnah7b A T 1: 46,282,525 (GRCm39) Q2886L probably damaging Het
Dock6 A T 9: 21,757,807 (GRCm39) V99E probably benign Het
F830045P16Rik T C 2: 129,316,352 (GRCm39) D119G possibly damaging Het
Fasn A T 11: 120,702,428 (GRCm39) L1773Q probably damaging Het
Filip1 A T 9: 79,725,241 (GRCm39) V1126E probably damaging Het
Fnta T C 8: 26,489,535 (GRCm39) I359V probably benign Het
Hoxc10 T C 15: 102,875,902 (GRCm39) S204P probably benign Het
Kif26b T C 1: 178,743,815 (GRCm39) C1304R probably benign Het
Lamc1 T C 1: 153,097,358 (GRCm39) E1562G probably benign Het
Lrguk A G 6: 34,033,038 (GRCm39) N235D probably benign Het
Ly6g6f T C 17: 35,300,060 (GRCm39) R263G possibly damaging Het
Mcrs1 C A 15: 99,147,766 (GRCm39) S47I probably damaging Het
Mx1 T A 16: 97,258,572 (GRCm39) I42F probably damaging Het
Nrp2 C T 1: 62,784,567 (GRCm39) R239C probably damaging Het
Nup188 T A 2: 30,227,277 (GRCm39) C1235S possibly damaging Het
Obsl1 T A 1: 75,469,317 (GRCm39) H1208L probably benign Het
Pcmt1 T C 10: 7,516,527 (GRCm39) D175G probably benign Het
Pcolce T C 5: 137,603,457 (GRCm39) K459E probably benign Het
Pudp T G 18: 50,701,310 (GRCm39) H141P possibly damaging Het
Rock2 T C 12: 16,992,743 (GRCm39) Y171H probably damaging Het
Rwdd1 A C 10: 33,885,198 (GRCm39) probably benign Het
Sbno1 A G 5: 124,522,565 (GRCm39) V1085A probably benign Het
Tie1 A G 4: 118,343,678 (GRCm39) L88P possibly damaging Het
Tmem131 T C 1: 36,847,045 (GRCm39) D1351G probably damaging Het
Tph1 A T 7: 46,306,303 (GRCm39) D219E probably damaging Het
Wdr86 A G 5: 24,935,177 (GRCm39) probably null Het
Other mutations in Dhcr24
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01305:Dhcr24 APN 4 106,429,475 (GRCm39) missense possibly damaging 0.50
IGL01548:Dhcr24 APN 4 106,431,068 (GRCm39) nonsense probably null
IGL02110:Dhcr24 APN 4 106,430,998 (GRCm39) missense probably damaging 1.00
IGL02256:Dhcr24 APN 4 106,429,517 (GRCm39) missense probably damaging 0.98
IGL02748:Dhcr24 APN 4 106,421,589 (GRCm39) splice site probably benign
IGL02926:Dhcr24 APN 4 106,443,552 (GRCm39) missense probably damaging 0.98
ANU22:Dhcr24 UTSW 4 106,429,475 (GRCm39) missense possibly damaging 0.50
R0423:Dhcr24 UTSW 4 106,443,733 (GRCm39) unclassified probably benign
R1632:Dhcr24 UTSW 4 106,443,148 (GRCm39) missense probably benign
R1771:Dhcr24 UTSW 4 106,435,450 (GRCm39) missense probably benign 0.00
R2138:Dhcr24 UTSW 4 106,429,499 (GRCm39) nonsense probably null
R2139:Dhcr24 UTSW 4 106,429,499 (GRCm39) nonsense probably null
R2420:Dhcr24 UTSW 4 106,418,291 (GRCm39) start gained probably benign
R2422:Dhcr24 UTSW 4 106,418,291 (GRCm39) start gained probably benign
R2570:Dhcr24 UTSW 4 106,443,029 (GRCm39) missense probably benign 0.00
R3176:Dhcr24 UTSW 4 106,418,436 (GRCm39) missense probably benign 0.16
R3276:Dhcr24 UTSW 4 106,418,436 (GRCm39) missense probably benign 0.16
R3842:Dhcr24 UTSW 4 106,443,002 (GRCm39) missense probably damaging 1.00
R3852:Dhcr24 UTSW 4 106,431,070 (GRCm39) missense probably benign 0.02
R4037:Dhcr24 UTSW 4 106,431,075 (GRCm39) missense probably benign 0.01
R4038:Dhcr24 UTSW 4 106,431,075 (GRCm39) missense probably benign 0.01
R4039:Dhcr24 UTSW 4 106,431,075 (GRCm39) missense probably benign 0.01
R5831:Dhcr24 UTSW 4 106,421,611 (GRCm39) missense probably benign 0.03
R7285:Dhcr24 UTSW 4 106,428,716 (GRCm39) critical splice donor site probably null
R7821:Dhcr24 UTSW 4 106,428,633 (GRCm39) missense possibly damaging 0.61
R8879:Dhcr24 UTSW 4 106,431,006 (GRCm39) missense probably benign 0.05
X0057:Dhcr24 UTSW 4 106,443,542 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGCCACGTGTGAAGCACTTC -3'
(R):5'- GTTTCTTTTCTGAGACCTGGGAAAG -3'

Sequencing Primer
(F):5'- TGTGAAGCACTTCGAGGC -3'
(R):5'- TTTTCTGAGACCTGGGAAAGCAGAG -3'
Posted On 2020-01-23