Incidental Mutation 'R8012:Chpf2'
ID616943
Institutional Source Beutler Lab
Gene Symbol Chpf2
Ensembl Gene ENSMUSG00000038181
Gene Namechondroitin polymerizing factor 2
Synonyms2010209O12Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.080) question?
Stock #R8012 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location24586741-24594556 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 24590345 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 289 (R289W)
Ref Sequence ENSEMBL: ENSMUSP00000085633 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030791] [ENSMUST00000088295] [ENSMUST00000121863] [ENSMUST00000195943] [ENSMUST00000197318]
Predicted Effect probably benign
Transcript: ENSMUST00000030791
SMART Domains Protein: ENSMUSP00000030791
Gene: ENSMUSG00000028949

DomainStartEndE-ValueType
low complexity region 40 55 N/A INTRINSIC
low complexity region 72 89 N/A INTRINSIC
low complexity region 93 102 N/A INTRINSIC
Blast:KISc 103 239 5e-41 BLAST
SWIB 259 338 3.6e-29 SMART
Blast:MYSc 420 466 1e-11 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000088295
AA Change: R289W

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000085633
Gene: ENSMUSG00000038181
AA Change: R289W

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Fringe 143 298 3.2e-11 PFAM
Pfam:CHGN 242 755 1.7e-144 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000121863
AA Change: R289W

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000112804
Gene: ENSMUSG00000038181
AA Change: R289W

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Fringe 143 298 3.2e-11 PFAM
Pfam:CHGN 242 755 3e-176 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000195943
SMART Domains Protein: ENSMUSP00000143437
Gene: ENSMUSG00000028949

DomainStartEndE-ValueType
low complexity region 11 26 N/A INTRINSIC
low complexity region 43 60 N/A INTRINSIC
low complexity region 64 73 N/A INTRINSIC
Blast:KISc 74 210 2e-41 BLAST
SWIB 230 309 2.3e-31 SMART
Blast:MYSc 391 437 8e-12 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000197318
SMART Domains Protein: ENSMUSP00000143185
Gene: ENSMUSG00000038181

DomainStartEndE-ValueType
Pfam:CHGN 1 74 7.5e-22 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 100% (44/44)
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930021J03Rik A G 19: 29,718,134 S1320P possibly damaging Het
Adam19 A G 11: 46,065,046 E73G possibly damaging Het
Akap13 G A 7: 75,730,465 R462H probably damaging Het
Alas1 A T 9: 106,246,763 N65K probably benign Het
Amigo1 T A 3: 108,188,642 S486T probably damaging Het
Arid1a A G 4: 133,692,863 L591S unknown Het
Asic1 T C 15: 99,696,651 V326A possibly damaging Het
Aspm A G 1: 139,457,464 N282S probably benign Het
Atad5 A G 11: 80,094,240 D51G probably damaging Het
Cabp5 A T 7: 13,407,781 probably null Het
Cdca2 A G 14: 67,677,372 C813R probably benign Het
Csf1r A T 18: 61,117,064 N367I possibly damaging Het
Cyp2c66 T C 19: 39,183,925 F428S probably damaging Het
Dgkb A T 12: 38,139,486 N296I probably benign Het
Dhcr24 T C 4: 106,586,656 F481S probably damaging Het
Diaph3 T C 14: 87,037,522 Y166C probably benign Het
Dnah7b A T 1: 46,243,365 Q2886L probably damaging Het
Dock6 A T 9: 21,846,511 V99E probably benign Het
F830045P16Rik T C 2: 129,474,432 D119G possibly damaging Het
Fasn A T 11: 120,811,602 L1773Q probably damaging Het
Filip1 A T 9: 79,817,959 V1126E probably damaging Het
Fnta T C 8: 25,999,507 I359V probably benign Het
Gm13178 T A 4: 144,703,402 D339V possibly damaging Het
Hoxc10 T C 15: 102,967,467 S204P probably benign Het
Kif26b T C 1: 178,916,250 C1304R probably benign Het
Lamc1 T C 1: 153,221,612 E1562G probably benign Het
Lrguk A G 6: 34,056,103 N235D probably benign Het
Ly6g6f T C 17: 35,081,084 R263G possibly damaging Het
Mcrs1 C A 15: 99,249,885 S47I probably damaging Het
Mx1 T A 16: 97,457,372 I42F probably damaging Het
Nrp2 C T 1: 62,745,408 R239C probably damaging Het
Nup188 T A 2: 30,337,265 C1235S possibly damaging Het
Obsl1 T A 1: 75,492,673 H1208L probably benign Het
Pcmt1 T C 10: 7,640,763 D175G probably benign Het
Pcolce T C 5: 137,605,195 K459E probably benign Het
Pudp T G 18: 50,568,239 H141P possibly damaging Het
Rock2 T C 12: 16,942,742 Y171H probably damaging Het
Rwdd1 A C 10: 34,009,202 probably benign Het
Sbno1 A G 5: 124,384,502 V1085A probably benign Het
Tie1 A G 4: 118,486,481 L88P possibly damaging Het
Tmem131 T C 1: 36,807,964 D1351G probably damaging Het
Tph1 A T 7: 46,656,879 D219E probably damaging Het
Wdr86 A G 5: 24,730,179 probably null Het
Other mutations in Chpf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00850:Chpf2 APN 5 24592261 missense probably damaging 1.00
IGL02110:Chpf2 APN 5 24591712 missense probably damaging 1.00
IGL02625:Chpf2 APN 5 24591711 nonsense probably null
IGL02673:Chpf2 APN 5 24591304 missense probably benign 0.21
R0545:Chpf2 UTSW 5 24590324 missense possibly damaging 0.89
R0571:Chpf2 UTSW 5 24590427 missense probably damaging 1.00
R0732:Chpf2 UTSW 5 24590421 start codon destroyed probably null 0.94
R1196:Chpf2 UTSW 5 24589648 missense possibly damaging 0.61
R2051:Chpf2 UTSW 5 24591276 missense probably benign 0.00
R2057:Chpf2 UTSW 5 24591222 missense probably damaging 1.00
R2147:Chpf2 UTSW 5 24592035 missense probably damaging 1.00
R3719:Chpf2 UTSW 5 24590312 nonsense probably null
R4168:Chpf2 UTSW 5 24591790 missense possibly damaging 0.86
R4632:Chpf2 UTSW 5 24591831 missense probably benign
R5278:Chpf2 UTSW 5 24588090 intron probably benign
R5481:Chpf2 UTSW 5 24589342 missense probably damaging 1.00
R5853:Chpf2 UTSW 5 24592192 missense probably damaging 1.00
R5914:Chpf2 UTSW 5 24592423 unclassified probably benign
R6010:Chpf2 UTSW 5 24591919 missense probably damaging 1.00
R6340:Chpf2 UTSW 5 24591775 missense probably damaging 0.98
R6463:Chpf2 UTSW 5 24589526 missense probably damaging 1.00
R8506:Chpf2 UTSW 5 24588297 missense probably damaging 1.00
Z1177:Chpf2 UTSW 5 24591519 frame shift probably null
Predicted Primers PCR Primer
(F):5'- AATGGAGGTTAGGGGTCCAC -3'
(R):5'- CTGGGAGTTTACCTACAAATTTGAC -3'

Sequencing Primer
(F):5'- AGGGGTCCACTGCTTCTC -3'
(R):5'- TCTAAGCTCCCAGCCATGG -3'
Posted On2020-01-23