Incidental Mutation 'R8012:Lrguk'
ID 616947
Institutional Source Beutler Lab
Gene Symbol Lrguk
Ensembl Gene ENSMUSG00000056215
Gene Name leucine-rich repeats and guanylate kinase domain containing
Synonyms 4921528H16Rik
MMRRC Submission 046052-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.094) question?
Stock # R8012 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 34006379-34110969 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 34033038 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Aspartic acid at position 235 (N235D)
Ref Sequence ENSEMBL: ENSMUSP00000065146 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070189] [ENSMUST00000228187]
AlphaFold Q9D5S7
Predicted Effect probably benign
Transcript: ENSMUST00000070189
AA Change: N235D

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000065146
Gene: ENSMUSG00000056215
AA Change: N235D

DomainStartEndE-ValueType
coiled coil region 75 113 N/A INTRINSIC
LRR 148 170 2.69e2 SMART
LRR 236 258 1.86e2 SMART
LRR 279 301 1.99e0 SMART
LRR 326 349 1.58e2 SMART
GuKc 414 600 6.84e-18 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000228187
AA Change: N235D

PolyPhen 2 Score 0.821 (Sensitivity: 0.84; Specificity: 0.93)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 100% (44/44)
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AAdacl4fm3 T A 4: 144,429,972 (GRCm39) D339V possibly damaging Het
Adam19 A G 11: 45,955,873 (GRCm39) E73G possibly damaging Het
Akap13 G A 7: 75,380,213 (GRCm39) R462H probably damaging Het
Alas1 A T 9: 106,123,962 (GRCm39) N65K probably benign Het
Amigo1 T A 3: 108,095,958 (GRCm39) S486T probably damaging Het
Arid1a A G 4: 133,420,174 (GRCm39) L591S unknown Het
Asic1 T C 15: 99,594,532 (GRCm39) V326A possibly damaging Het
Aspm A G 1: 139,385,202 (GRCm39) N282S probably benign Het
Atad5 A G 11: 79,985,066 (GRCm39) D51G probably damaging Het
Brd10 A G 19: 29,695,534 (GRCm39) S1320P possibly damaging Het
Cabp5 A T 7: 13,141,706 (GRCm39) probably null Het
Cdca2 A G 14: 67,914,821 (GRCm39) C813R probably benign Het
Chpf2 A T 5: 24,795,343 (GRCm39) R289W probably damaging Het
Csf1r A T 18: 61,250,136 (GRCm39) N367I possibly damaging Het
Cyp2c66 T C 19: 39,172,369 (GRCm39) F428S probably damaging Het
Dgkb A T 12: 38,189,485 (GRCm39) N296I probably benign Het
Dhcr24 T C 4: 106,443,853 (GRCm39) F481S probably damaging Het
Diaph3 T C 14: 87,274,958 (GRCm39) Y166C probably benign Het
Dnah7b A T 1: 46,282,525 (GRCm39) Q2886L probably damaging Het
Dock6 A T 9: 21,757,807 (GRCm39) V99E probably benign Het
F830045P16Rik T C 2: 129,316,352 (GRCm39) D119G possibly damaging Het
Fasn A T 11: 120,702,428 (GRCm39) L1773Q probably damaging Het
Filip1 A T 9: 79,725,241 (GRCm39) V1126E probably damaging Het
Fnta T C 8: 26,489,535 (GRCm39) I359V probably benign Het
Hoxc10 T C 15: 102,875,902 (GRCm39) S204P probably benign Het
Kif26b T C 1: 178,743,815 (GRCm39) C1304R probably benign Het
Lamc1 T C 1: 153,097,358 (GRCm39) E1562G probably benign Het
Ly6g6f T C 17: 35,300,060 (GRCm39) R263G possibly damaging Het
Mcrs1 C A 15: 99,147,766 (GRCm39) S47I probably damaging Het
Mx1 T A 16: 97,258,572 (GRCm39) I42F probably damaging Het
Nrp2 C T 1: 62,784,567 (GRCm39) R239C probably damaging Het
Nup188 T A 2: 30,227,277 (GRCm39) C1235S possibly damaging Het
Obsl1 T A 1: 75,469,317 (GRCm39) H1208L probably benign Het
Pcmt1 T C 10: 7,516,527 (GRCm39) D175G probably benign Het
Pcolce T C 5: 137,603,457 (GRCm39) K459E probably benign Het
Pudp T G 18: 50,701,310 (GRCm39) H141P possibly damaging Het
Rock2 T C 12: 16,992,743 (GRCm39) Y171H probably damaging Het
Rwdd1 A C 10: 33,885,198 (GRCm39) probably benign Het
Sbno1 A G 5: 124,522,565 (GRCm39) V1085A probably benign Het
Tie1 A G 4: 118,343,678 (GRCm39) L88P possibly damaging Het
Tmem131 T C 1: 36,847,045 (GRCm39) D1351G probably damaging Het
Tph1 A T 7: 46,306,303 (GRCm39) D219E probably damaging Het
Wdr86 A G 5: 24,935,177 (GRCm39) probably null Het
Other mutations in Lrguk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00339:Lrguk APN 6 34,020,364 (GRCm39) missense probably damaging 1.00
IGL00566:Lrguk APN 6 34,033,109 (GRCm39) missense probably damaging 1.00
IGL01720:Lrguk APN 6 34,020,412 (GRCm39) missense probably damaging 1.00
IGL02325:Lrguk APN 6 34,106,114 (GRCm39) missense probably benign 0.31
IGL02484:Lrguk APN 6 34,069,726 (GRCm39) missense probably damaging 1.00
IGL02493:Lrguk APN 6 34,106,127 (GRCm39) missense probably benign 0.03
IGL02636:Lrguk APN 6 34,067,123 (GRCm39) missense probably damaging 1.00
IGL03278:Lrguk APN 6 34,093,381 (GRCm39) missense possibly damaging 0.80
R0031:Lrguk UTSW 6 34,020,431 (GRCm39) missense probably damaging 0.99
R1069:Lrguk UTSW 6 34,025,818 (GRCm39) missense possibly damaging 0.63
R1487:Lrguk UTSW 6 34,039,295 (GRCm39) missense probably benign 0.01
R1568:Lrguk UTSW 6 34,063,373 (GRCm39) missense probably damaging 1.00
R1604:Lrguk UTSW 6 34,049,305 (GRCm39) missense possibly damaging 0.67
R1847:Lrguk UTSW 6 34,110,322 (GRCm39) missense possibly damaging 0.52
R2045:Lrguk UTSW 6 34,048,003 (GRCm39) missense probably damaging 1.00
R2107:Lrguk UTSW 6 34,039,296 (GRCm39) missense probably benign 0.15
R2125:Lrguk UTSW 6 34,069,837 (GRCm39) missense probably benign 0.05
R2136:Lrguk UTSW 6 34,020,454 (GRCm39) missense probably benign 0.00
R2997:Lrguk UTSW 6 34,050,697 (GRCm39) missense probably damaging 0.98
R3847:Lrguk UTSW 6 34,050,703 (GRCm39) missense probably damaging 1.00
R3849:Lrguk UTSW 6 34,050,703 (GRCm39) missense probably damaging 1.00
R4626:Lrguk UTSW 6 34,106,158 (GRCm39) missense probably benign 0.00
R4718:Lrguk UTSW 6 34,006,431 (GRCm39) missense probably benign 0.02
R4778:Lrguk UTSW 6 34,033,015 (GRCm39) missense probably damaging 1.00
R4841:Lrguk UTSW 6 34,069,802 (GRCm39) missense probably damaging 0.98
R5324:Lrguk UTSW 6 34,050,732 (GRCm39) missense possibly damaging 0.87
R5450:Lrguk UTSW 6 34,047,996 (GRCm39) missense probably damaging 1.00
R5741:Lrguk UTSW 6 34,025,802 (GRCm39) missense probably damaging 0.99
R5939:Lrguk UTSW 6 34,055,688 (GRCm39) missense probably damaging 1.00
R5997:Lrguk UTSW 6 34,106,078 (GRCm39) missense probably damaging 0.99
R6786:Lrguk UTSW 6 34,072,522 (GRCm39) missense probably benign 0.11
R6802:Lrguk UTSW 6 34,039,392 (GRCm39) missense probably damaging 1.00
R7081:Lrguk UTSW 6 34,079,074 (GRCm39) missense probably benign 0.01
R7303:Lrguk UTSW 6 34,006,411 (GRCm39) missense probably benign 0.00
R7316:Lrguk UTSW 6 34,080,191 (GRCm39) missense unknown
R7473:Lrguk UTSW 6 34,006,630 (GRCm39) missense probably benign 0.01
R7543:Lrguk UTSW 6 34,025,870 (GRCm39) nonsense probably null
R7613:Lrguk UTSW 6 34,078,683 (GRCm39) missense possibly damaging 0.68
R7716:Lrguk UTSW 6 34,072,474 (GRCm39) missense probably damaging 1.00
R7900:Lrguk UTSW 6 34,106,129 (GRCm39) missense probably benign 0.01
R8251:Lrguk UTSW 6 34,093,374 (GRCm39) missense probably benign 0.00
R8324:Lrguk UTSW 6 34,079,506 (GRCm39) missense probably benign 0.03
R8551:Lrguk UTSW 6 34,093,446 (GRCm39) missense probably damaging 0.96
R8828:Lrguk UTSW 6 34,080,572 (GRCm39) missense unknown
R8879:Lrguk UTSW 6 34,006,618 (GRCm39) missense probably benign 0.00
X0057:Lrguk UTSW 6 34,055,682 (GRCm39) missense probably benign 0.40
Predicted Primers PCR Primer
(F):5'- TGTGGGGTACATAACATTCCC -3'
(R):5'- ACTGGCTTTACTTGAACATGGAC -3'

Sequencing Primer
(F):5'- CTTGTGTGAATGTCAAAGGACCAC -3'
(R):5'- GGCTTTACTTGAACATGGACTATTG -3'
Posted On 2020-01-23