Incidental Mutation 'R8012:Lrguk'
ID 616947
Institutional Source Beutler Lab
Gene Symbol Lrguk
Ensembl Gene ENSMUSG00000056215
Gene Name leucine-rich repeats and guanylate kinase domain containing
Synonyms 4921528H16Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.101) question?
Stock # R8012 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 34029448-34134034 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 34056103 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Aspartic acid at position 235 (N235D)
Ref Sequence ENSEMBL: ENSMUSP00000065146 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070189] [ENSMUST00000228187]
AlphaFold Q9D5S7
Predicted Effect probably benign
Transcript: ENSMUST00000070189
AA Change: N235D

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000065146
Gene: ENSMUSG00000056215
AA Change: N235D

DomainStartEndE-ValueType
coiled coil region 75 113 N/A INTRINSIC
LRR 148 170 2.69e2 SMART
LRR 236 258 1.86e2 SMART
LRR 279 301 1.99e0 SMART
LRR 326 349 1.58e2 SMART
GuKc 414 600 6.84e-18 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000228187
AA Change: N235D

PolyPhen 2 Score 0.821 (Sensitivity: 0.84; Specificity: 0.93)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 100% (44/44)
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930021J03Rik A G 19: 29,718,134 S1320P possibly damaging Het
Adam19 A G 11: 46,065,046 E73G possibly damaging Het
Akap13 G A 7: 75,730,465 R462H probably damaging Het
Alas1 A T 9: 106,246,763 N65K probably benign Het
Amigo1 T A 3: 108,188,642 S486T probably damaging Het
Arid1a A G 4: 133,692,863 L591S unknown Het
Asic1 T C 15: 99,696,651 V326A possibly damaging Het
Aspm A G 1: 139,457,464 N282S probably benign Het
Atad5 A G 11: 80,094,240 D51G probably damaging Het
Cabp5 A T 7: 13,407,781 probably null Het
Cdca2 A G 14: 67,677,372 C813R probably benign Het
Chpf2 A T 5: 24,590,345 R289W probably damaging Het
Csf1r A T 18: 61,117,064 N367I possibly damaging Het
Cyp2c66 T C 19: 39,183,925 F428S probably damaging Het
Dgkb A T 12: 38,139,486 N296I probably benign Het
Dhcr24 T C 4: 106,586,656 F481S probably damaging Het
Diaph3 T C 14: 87,037,522 Y166C probably benign Het
Dnah7b A T 1: 46,243,365 Q2886L probably damaging Het
Dock6 A T 9: 21,846,511 V99E probably benign Het
F830045P16Rik T C 2: 129,474,432 D119G possibly damaging Het
Fasn A T 11: 120,811,602 L1773Q probably damaging Het
Filip1 A T 9: 79,817,959 V1126E probably damaging Het
Fnta T C 8: 25,999,507 I359V probably benign Het
Gm13178 T A 4: 144,703,402 D339V possibly damaging Het
Hoxc10 T C 15: 102,967,467 S204P probably benign Het
Kif26b T C 1: 178,916,250 C1304R probably benign Het
Lamc1 T C 1: 153,221,612 E1562G probably benign Het
Ly6g6f T C 17: 35,081,084 R263G possibly damaging Het
Mcrs1 C A 15: 99,249,885 S47I probably damaging Het
Mx1 T A 16: 97,457,372 I42F probably damaging Het
Nrp2 C T 1: 62,745,408 R239C probably damaging Het
Nup188 T A 2: 30,337,265 C1235S possibly damaging Het
Obsl1 T A 1: 75,492,673 H1208L probably benign Het
Pcmt1 T C 10: 7,640,763 D175G probably benign Het
Pcolce T C 5: 137,605,195 K459E probably benign Het
Pudp T G 18: 50,568,239 H141P possibly damaging Het
Rock2 T C 12: 16,942,742 Y171H probably damaging Het
Rwdd1 A C 10: 34,009,202 probably benign Het
Sbno1 A G 5: 124,384,502 V1085A probably benign Het
Tie1 A G 4: 118,486,481 L88P possibly damaging Het
Tmem131 T C 1: 36,807,964 D1351G probably damaging Het
Tph1 A T 7: 46,656,879 D219E probably damaging Het
Wdr86 A G 5: 24,730,179 probably null Het
Other mutations in Lrguk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00339:Lrguk APN 6 34043429 missense probably damaging 1.00
IGL00566:Lrguk APN 6 34056174 missense probably damaging 1.00
IGL01720:Lrguk APN 6 34043477 missense probably damaging 1.00
IGL02325:Lrguk APN 6 34129179 missense probably benign 0.31
IGL02484:Lrguk APN 6 34092791 missense probably damaging 1.00
IGL02493:Lrguk APN 6 34129192 missense probably benign 0.03
IGL02636:Lrguk APN 6 34090188 missense probably damaging 1.00
IGL03278:Lrguk APN 6 34116446 missense possibly damaging 0.80
R0031:Lrguk UTSW 6 34043496 missense probably damaging 0.99
R1069:Lrguk UTSW 6 34048883 missense possibly damaging 0.63
R1487:Lrguk UTSW 6 34062360 missense probably benign 0.01
R1568:Lrguk UTSW 6 34086438 missense probably damaging 1.00
R1604:Lrguk UTSW 6 34072370 missense possibly damaging 0.67
R1847:Lrguk UTSW 6 34133387 missense possibly damaging 0.52
R2045:Lrguk UTSW 6 34071068 missense probably damaging 1.00
R2107:Lrguk UTSW 6 34062361 missense probably benign 0.15
R2125:Lrguk UTSW 6 34092902 missense probably benign 0.05
R2136:Lrguk UTSW 6 34043519 missense probably benign 0.00
R2997:Lrguk UTSW 6 34073762 missense probably damaging 0.98
R3847:Lrguk UTSW 6 34073768 missense probably damaging 1.00
R3849:Lrguk UTSW 6 34073768 missense probably damaging 1.00
R4626:Lrguk UTSW 6 34129223 missense probably benign 0.00
R4718:Lrguk UTSW 6 34029496 missense probably benign 0.02
R4778:Lrguk UTSW 6 34056080 missense probably damaging 1.00
R4841:Lrguk UTSW 6 34092867 missense probably damaging 0.98
R5324:Lrguk UTSW 6 34073797 missense possibly damaging 0.87
R5450:Lrguk UTSW 6 34071061 missense probably damaging 1.00
R5741:Lrguk UTSW 6 34048867 missense probably damaging 0.99
R5939:Lrguk UTSW 6 34078753 missense probably damaging 1.00
R5997:Lrguk UTSW 6 34129143 missense probably damaging 0.99
R6786:Lrguk UTSW 6 34095587 missense probably benign 0.11
R6802:Lrguk UTSW 6 34062457 missense probably damaging 1.00
R7081:Lrguk UTSW 6 34102139 missense probably benign 0.01
R7303:Lrguk UTSW 6 34029476 missense probably benign 0.00
R7316:Lrguk UTSW 6 34103256 missense unknown
R7473:Lrguk UTSW 6 34029695 missense probably benign 0.01
R7543:Lrguk UTSW 6 34048935 nonsense probably null
R7613:Lrguk UTSW 6 34101748 missense possibly damaging 0.68
R7716:Lrguk UTSW 6 34095539 missense probably damaging 1.00
R7900:Lrguk UTSW 6 34129194 missense probably benign 0.01
R8251:Lrguk UTSW 6 34116439 missense probably benign 0.00
R8324:Lrguk UTSW 6 34102571 missense probably benign 0.03
R8551:Lrguk UTSW 6 34116511 missense probably damaging 0.96
R8828:Lrguk UTSW 6 34103637 missense unknown
R8879:Lrguk UTSW 6 34029683 missense probably benign 0.00
X0057:Lrguk UTSW 6 34078747 missense probably benign 0.40
Predicted Primers PCR Primer
(F):5'- TGTGGGGTACATAACATTCCC -3'
(R):5'- ACTGGCTTTACTTGAACATGGAC -3'

Sequencing Primer
(F):5'- CTTGTGTGAATGTCAAAGGACCAC -3'
(R):5'- GGCTTTACTTGAACATGGACTATTG -3'
Posted On 2020-01-23