Incidental Mutation 'R8012:Atad5'
ID 616957
Institutional Source Beutler Lab
Gene Symbol Atad5
Ensembl Gene ENSMUSG00000017550
Gene Name ATPase family, AAA domain containing 5
Synonyms LOC237877, C130052G03Rik
MMRRC Submission 046052-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R8012 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 79980226-80026620 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 79985066 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 51 (D51G)
Ref Sequence ENSEMBL: ENSMUSP00000017694 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017694] [ENSMUST00000108239]
AlphaFold Q4QY64
Predicted Effect probably damaging
Transcript: ENSMUST00000017694
AA Change: D51G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000017694
Gene: ENSMUSG00000017550
AA Change: D51G

DomainStartEndE-ValueType
low complexity region 298 311 N/A INTRINSIC
low complexity region 327 342 N/A INTRINSIC
low complexity region 467 486 N/A INTRINSIC
coiled coil region 665 697 N/A INTRINSIC
low complexity region 798 807 N/A INTRINSIC
AAA 1111 1347 5.14e-5 SMART
Blast:AAA 1409 1526 1e-31 BLAST
low complexity region 1573 1583 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108239
AA Change: D51G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000103874
Gene: ENSMUSG00000017550
AA Change: D51G

DomainStartEndE-ValueType
low complexity region 298 311 N/A INTRINSIC
low complexity region 327 342 N/A INTRINSIC
low complexity region 467 486 N/A INTRINSIC
coiled coil region 665 697 N/A INTRINSIC
low complexity region 798 807 N/A INTRINSIC
AAA 1108 1344 5.14e-5 SMART
Blast:AAA 1406 1523 1e-31 BLAST
low complexity region 1570 1580 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 100% (44/44)
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trap allele exhibit prenatal lethality. Mice heterozygous for a gene trap allele exhibit genomic instability, premature death, and a wide spectrum of spontaneous tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AAdacl4fm3 T A 4: 144,429,972 (GRCm39) D339V possibly damaging Het
Adam19 A G 11: 45,955,873 (GRCm39) E73G possibly damaging Het
Akap13 G A 7: 75,380,213 (GRCm39) R462H probably damaging Het
Alas1 A T 9: 106,123,962 (GRCm39) N65K probably benign Het
Amigo1 T A 3: 108,095,958 (GRCm39) S486T probably damaging Het
Arid1a A G 4: 133,420,174 (GRCm39) L591S unknown Het
Asic1 T C 15: 99,594,532 (GRCm39) V326A possibly damaging Het
Aspm A G 1: 139,385,202 (GRCm39) N282S probably benign Het
Brd10 A G 19: 29,695,534 (GRCm39) S1320P possibly damaging Het
Cabp5 A T 7: 13,141,706 (GRCm39) probably null Het
Cdca2 A G 14: 67,914,821 (GRCm39) C813R probably benign Het
Chpf2 A T 5: 24,795,343 (GRCm39) R289W probably damaging Het
Csf1r A T 18: 61,250,136 (GRCm39) N367I possibly damaging Het
Cyp2c66 T C 19: 39,172,369 (GRCm39) F428S probably damaging Het
Dgkb A T 12: 38,189,485 (GRCm39) N296I probably benign Het
Dhcr24 T C 4: 106,443,853 (GRCm39) F481S probably damaging Het
Diaph3 T C 14: 87,274,958 (GRCm39) Y166C probably benign Het
Dnah7b A T 1: 46,282,525 (GRCm39) Q2886L probably damaging Het
Dock6 A T 9: 21,757,807 (GRCm39) V99E probably benign Het
F830045P16Rik T C 2: 129,316,352 (GRCm39) D119G possibly damaging Het
Fasn A T 11: 120,702,428 (GRCm39) L1773Q probably damaging Het
Filip1 A T 9: 79,725,241 (GRCm39) V1126E probably damaging Het
Fnta T C 8: 26,489,535 (GRCm39) I359V probably benign Het
Hoxc10 T C 15: 102,875,902 (GRCm39) S204P probably benign Het
Kif26b T C 1: 178,743,815 (GRCm39) C1304R probably benign Het
Lamc1 T C 1: 153,097,358 (GRCm39) E1562G probably benign Het
Lrguk A G 6: 34,033,038 (GRCm39) N235D probably benign Het
Ly6g6f T C 17: 35,300,060 (GRCm39) R263G possibly damaging Het
Mcrs1 C A 15: 99,147,766 (GRCm39) S47I probably damaging Het
Mx1 T A 16: 97,258,572 (GRCm39) I42F probably damaging Het
Nrp2 C T 1: 62,784,567 (GRCm39) R239C probably damaging Het
Nup188 T A 2: 30,227,277 (GRCm39) C1235S possibly damaging Het
Obsl1 T A 1: 75,469,317 (GRCm39) H1208L probably benign Het
Pcmt1 T C 10: 7,516,527 (GRCm39) D175G probably benign Het
Pcolce T C 5: 137,603,457 (GRCm39) K459E probably benign Het
Pudp T G 18: 50,701,310 (GRCm39) H141P possibly damaging Het
Rock2 T C 12: 16,992,743 (GRCm39) Y171H probably damaging Het
Rwdd1 A C 10: 33,885,198 (GRCm39) probably benign Het
Sbno1 A G 5: 124,522,565 (GRCm39) V1085A probably benign Het
Tie1 A G 4: 118,343,678 (GRCm39) L88P possibly damaging Het
Tmem131 T C 1: 36,847,045 (GRCm39) D1351G probably damaging Het
Tph1 A T 7: 46,306,303 (GRCm39) D219E probably damaging Het
Wdr86 A G 5: 24,935,177 (GRCm39) probably null Het
Other mutations in Atad5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00753:Atad5 APN 11 80,023,684 (GRCm39) missense probably benign 0.22
IGL00916:Atad5 APN 11 80,009,826 (GRCm39) missense probably damaging 1.00
IGL01348:Atad5 APN 11 79,986,390 (GRCm39) missense probably benign 0.00
IGL01601:Atad5 APN 11 79,986,343 (GRCm39) missense probably benign 0.45
IGL01916:Atad5 APN 11 80,003,665 (GRCm39) critical splice donor site probably null
IGL02028:Atad5 APN 11 80,024,936 (GRCm39) missense probably benign 0.20
IGL02095:Atad5 APN 11 79,985,533 (GRCm39) missense probably benign 0.24
IGL02142:Atad5 APN 11 79,985,023 (GRCm39) missense probably benign 0.00
IGL02206:Atad5 APN 11 79,985,009 (GRCm39) missense probably damaging 1.00
IGL02385:Atad5 APN 11 79,985,453 (GRCm39) missense probably benign 0.04
IGL02858:Atad5 APN 11 79,980,601 (GRCm39) missense probably damaging 1.00
IGL02962:Atad5 APN 11 79,999,405 (GRCm39) missense possibly damaging 0.86
PIT4362001:Atad5 UTSW 11 80,002,393 (GRCm39) missense probably benign 0.04
R0040:Atad5 UTSW 11 79,988,840 (GRCm39) missense probably benign
R0157:Atad5 UTSW 11 79,980,643 (GRCm39) missense possibly damaging 0.74
R0211:Atad5 UTSW 11 79,986,473 (GRCm39) missense probably benign 0.00
R0211:Atad5 UTSW 11 79,986,473 (GRCm39) missense probably benign 0.00
R0319:Atad5 UTSW 11 80,011,616 (GRCm39) splice site probably benign
R0401:Atad5 UTSW 11 80,011,525 (GRCm39) missense probably benign 0.11
R0426:Atad5 UTSW 11 80,003,658 (GRCm39) missense probably benign 0.14
R0452:Atad5 UTSW 11 79,997,247 (GRCm39) missense probably damaging 0.98
R0496:Atad5 UTSW 11 79,991,182 (GRCm39) missense probably benign 0.08
R1691:Atad5 UTSW 11 79,986,358 (GRCm39) missense probably benign 0.00
R1812:Atad5 UTSW 11 80,023,873 (GRCm39) missense probably damaging 0.98
R2070:Atad5 UTSW 11 79,988,878 (GRCm39) splice site probably null
R2071:Atad5 UTSW 11 79,988,878 (GRCm39) splice site probably null
R2153:Atad5 UTSW 11 79,997,203 (GRCm39) missense probably benign 0.04
R2415:Atad5 UTSW 11 79,985,077 (GRCm39) missense probably damaging 1.00
R3917:Atad5 UTSW 11 79,994,120 (GRCm39) missense probably null 0.97
R4025:Atad5 UTSW 11 80,011,512 (GRCm39) missense probably damaging 1.00
R4464:Atad5 UTSW 11 79,991,137 (GRCm39) splice site probably null
R4561:Atad5 UTSW 11 79,986,715 (GRCm39) missense probably benign 0.01
R4579:Atad5 UTSW 11 79,986,017 (GRCm39) missense probably damaging 1.00
R4844:Atad5 UTSW 11 80,005,137 (GRCm39) splice site probably null
R4853:Atad5 UTSW 11 79,986,098 (GRCm39) missense probably damaging 1.00
R4873:Atad5 UTSW 11 80,011,515 (GRCm39) missense probably damaging 1.00
R4875:Atad5 UTSW 11 80,011,515 (GRCm39) missense probably damaging 1.00
R5054:Atad5 UTSW 11 79,985,502 (GRCm39) missense probably benign 0.10
R5226:Atad5 UTSW 11 79,985,888 (GRCm39) missense probably damaging 0.99
R5397:Atad5 UTSW 11 80,002,319 (GRCm39) missense probably damaging 1.00
R5449:Atad5 UTSW 11 80,014,934 (GRCm39) missense probably damaging 1.00
R5571:Atad5 UTSW 11 80,002,382 (GRCm39) missense probably benign 0.05
R5575:Atad5 UTSW 11 79,991,149 (GRCm39) missense probably benign 0.02
R5857:Atad5 UTSW 11 80,022,155 (GRCm39) missense probably benign 0.06
R5927:Atad5 UTSW 11 80,018,111 (GRCm39) missense probably damaging 1.00
R5928:Atad5 UTSW 11 79,985,003 (GRCm39) missense probably damaging 1.00
R5949:Atad5 UTSW 11 79,986,835 (GRCm39) nonsense probably null
R6102:Atad5 UTSW 11 80,002,398 (GRCm39) critical splice donor site probably null
R6254:Atad5 UTSW 11 80,018,215 (GRCm39) missense probably damaging 0.96
R6562:Atad5 UTSW 11 80,024,032 (GRCm39) missense probably benign 0.26
R6744:Atad5 UTSW 11 80,024,858 (GRCm39) missense probably benign 0.00
R7092:Atad5 UTSW 11 80,011,546 (GRCm39) missense possibly damaging 0.68
R7202:Atad5 UTSW 11 79,980,601 (GRCm39) missense probably damaging 1.00
R7345:Atad5 UTSW 11 79,986,832 (GRCm39) missense probably damaging 1.00
R7352:Atad5 UTSW 11 79,994,169 (GRCm39) critical splice donor site probably null
R7358:Atad5 UTSW 11 80,023,862 (GRCm39) missense probably benign 0.32
R7420:Atad5 UTSW 11 79,986,688 (GRCm39) missense probably benign 0.06
R7453:Atad5 UTSW 11 80,009,969 (GRCm39) critical splice donor site probably null
R7990:Atad5 UTSW 11 80,024,079 (GRCm39) nonsense probably null
R8152:Atad5 UTSW 11 79,985,996 (GRCm39) missense possibly damaging 0.59
R8421:Atad5 UTSW 11 79,985,384 (GRCm39) missense probably damaging 0.98
R8842:Atad5 UTSW 11 80,000,910 (GRCm39) missense possibly damaging 0.87
R8918:Atad5 UTSW 11 79,986,473 (GRCm39) missense probably benign 0.02
R8943:Atad5 UTSW 11 79,986,524 (GRCm39) missense possibly damaging 0.86
R8944:Atad5 UTSW 11 79,986,524 (GRCm39) missense possibly damaging 0.86
R9134:Atad5 UTSW 11 80,023,931 (GRCm39) missense probably benign 0.00
R9137:Atad5 UTSW 11 79,986,481 (GRCm39) missense probably damaging 1.00
R9301:Atad5 UTSW 11 79,986,845 (GRCm39) missense probably damaging 1.00
R9372:Atad5 UTSW 11 79,985,094 (GRCm39) missense possibly damaging 0.68
R9404:Atad5 UTSW 11 80,005,064 (GRCm39) missense probably damaging 1.00
R9443:Atad5 UTSW 11 80,023,388 (GRCm39) missense probably benign 0.01
R9471:Atad5 UTSW 11 80,023,524 (GRCm39) missense possibly damaging 0.65
R9577:Atad5 UTSW 11 80,004,996 (GRCm39) missense probably damaging 1.00
R9656:Atad5 UTSW 11 79,980,542 (GRCm39) start gained probably benign
R9659:Atad5 UTSW 11 79,980,542 (GRCm39) start gained probably benign
R9661:Atad5 UTSW 11 79,980,542 (GRCm39) start gained probably benign
RF003:Atad5 UTSW 11 80,002,386 (GRCm39) missense probably damaging 0.99
X0024:Atad5 UTSW 11 80,023,609 (GRCm39) missense probably benign 0.02
Z1176:Atad5 UTSW 11 79,985,722 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGTATATACAATGGAGCCTTCTG -3'
(R):5'- TTCAACTGGACACTCATCCTG -3'

Sequencing Primer
(F):5'- ACAATGGAGCCTTCTGTAGTTTTTC -3'
(R):5'- TCAGTTGAGAGGATAAACTAACTCTC -3'
Posted On 2020-01-23