Incidental Mutation 'R8012:Asic1'
ID616964
Institutional Source Beutler Lab
Gene Symbol Asic1
Ensembl Gene ENSMUSG00000023017
Gene Nameacid-sensing (proton-gated) ion channel 1
SynonymsASIC1a, ASICalpha, B530003N02Rik, ASIC, Accn2, BNaC2, ASIC1 beta
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.161) question?
Stock #R8012 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location99670368-99701130 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 99696651 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 326 (V326A)
Ref Sequence ENSEMBL: ENSMUSP00000023758 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023758] [ENSMUST00000228185]
Predicted Effect possibly damaging
Transcript: ENSMUST00000023758
AA Change: V326A

PolyPhen 2 Score 0.918 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000023758
Gene: ENSMUSG00000023017
AA Change: V326A

DomainStartEndE-ValueType
Pfam:ASC 21 454 9.9e-95 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000228185
AA Change: V359A

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the acid-sensing ion channel (ASIC) family of proteins, which are part of the degenerin/epithelial sodium channel (DEG/ENaC) superfamily. Members of the ASIC family are sensitive to amiloride and function in neurotransmission. The encoded proteins function in learning, pain transduction, touch sensation, and development of memory and fear. Alternatively spliced transcript variants have been described. [provided by RefSeq, Feb 2012]
PHENOTYPE: Homozygous mutation of this gene results in absence of H+-gated currents in hippocampal neurons, impaired long term potentiation, reduced excitatory postsynaptic potentials, and defective spatial learning and eye blink conditioning. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930021J03Rik A G 19: 29,718,134 S1320P possibly damaging Het
Adam19 A G 11: 46,065,046 E73G possibly damaging Het
Akap13 G A 7: 75,730,465 R462H probably damaging Het
Alas1 A T 9: 106,246,763 N65K probably benign Het
Amigo1 T A 3: 108,188,642 S486T probably damaging Het
Arid1a A G 4: 133,692,863 L591S unknown Het
Aspm A G 1: 139,457,464 N282S probably benign Het
Atad5 A G 11: 80,094,240 D51G probably damaging Het
Cabp5 A T 7: 13,407,781 probably null Het
Cdca2 A G 14: 67,677,372 C813R probably benign Het
Chpf2 A T 5: 24,590,345 R289W probably damaging Het
Csf1r A T 18: 61,117,064 N367I possibly damaging Het
Cyp2c66 T C 19: 39,183,925 F428S probably damaging Het
Dgkb A T 12: 38,139,486 N296I probably benign Het
Dhcr24 T C 4: 106,586,656 F481S probably damaging Het
Diaph3 T C 14: 87,037,522 Y166C probably benign Het
Dnah7b A T 1: 46,243,365 Q2886L probably damaging Het
Dock6 A T 9: 21,846,511 V99E probably benign Het
F830045P16Rik T C 2: 129,474,432 D119G possibly damaging Het
Fasn A T 11: 120,811,602 L1773Q probably damaging Het
Filip1 A T 9: 79,817,959 V1126E probably damaging Het
Fnta T C 8: 25,999,507 I359V probably benign Het
Gm13178 T A 4: 144,703,402 D339V possibly damaging Het
Hoxc10 T C 15: 102,967,467 S204P probably benign Het
Kif26b T C 1: 178,916,250 C1304R probably benign Het
Lamc1 T C 1: 153,221,612 E1562G probably benign Het
Lrguk A G 6: 34,056,103 N235D probably benign Het
Ly6g6f T C 17: 35,081,084 R263G possibly damaging Het
Mcrs1 C A 15: 99,249,885 S47I probably damaging Het
Mx1 T A 16: 97,457,372 I42F probably damaging Het
Nrp2 C T 1: 62,745,408 R239C probably damaging Het
Nup188 T A 2: 30,337,265 C1235S possibly damaging Het
Obsl1 T A 1: 75,492,673 H1208L probably benign Het
Pcmt1 T C 10: 7,640,763 D175G probably benign Het
Pcolce T C 5: 137,605,195 K459E probably benign Het
Pudp T G 18: 50,568,239 H141P possibly damaging Het
Rock2 T C 12: 16,942,742 Y171H probably damaging Het
Sbno1 A G 5: 124,384,502 V1085A probably benign Het
Tie1 A G 4: 118,486,481 L88P possibly damaging Het
Tmem131 T C 1: 36,807,964 D1351G probably damaging Het
Tph1 A T 7: 46,656,879 D219E probably damaging Het
Wdr86 A G 5: 24,730,179 probably null Het
Other mutations in Asic1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01413:Asic1 APN 15 99672117 missense probably damaging 0.99
IGL01418:Asic1 APN 15 99672117 missense probably damaging 0.99
IGL01718:Asic1 APN 15 99672002 missense probably damaging 1.00
IGL01941:Asic1 APN 15 99699101 missense possibly damaging 0.95
IGL01993:Asic1 APN 15 99697472 missense probably benign 0.01
IGL02097:Asic1 APN 15 99694686 splice site probably benign
IGL03028:Asic1 APN 15 99672157 missense probably benign 0.03
IGL03082:Asic1 APN 15 99696547 missense probably benign
IGL03183:Asic1 APN 15 99672017 missense probably benign 0.43
IGL03231:Asic1 APN 15 99699102 missense probably benign 0.42
R0111:Asic1 UTSW 15 99696983 missense probably damaging 1.00
R0243:Asic1 UTSW 15 99698617 unclassified probably benign
R0316:Asic1 UTSW 15 99671938 missense probably benign 0.03
R0518:Asic1 UTSW 15 99698819 missense probably damaging 1.00
R0520:Asic1 UTSW 15 99695535 missense probably damaging 1.00
R0521:Asic1 UTSW 15 99698819 missense probably damaging 1.00
R0610:Asic1 UTSW 15 99698899 missense probably benign 0.14
R1034:Asic1 UTSW 15 99698058 missense probably damaging 1.00
R1666:Asic1 UTSW 15 99699125 missense probably damaging 1.00
R1796:Asic1 UTSW 15 99696654 missense probably null 0.99
R1993:Asic1 UTSW 15 99671884 missense probably damaging 1.00
R2130:Asic1 UTSW 15 99671875 missense possibly damaging 0.73
R2180:Asic1 UTSW 15 99671965 missense probably benign
R2895:Asic1 UTSW 15 99696602 missense probably benign 0.22
R3793:Asic1 UTSW 15 99672025 nonsense probably null
R3848:Asic1 UTSW 15 99672933 missense probably benign 0.01
R5115:Asic1 UTSW 15 99672052 missense probably damaging 0.97
R5186:Asic1 UTSW 15 99698803 unclassified probably benign
R5187:Asic1 UTSW 15 99698803 unclassified probably benign
R5409:Asic1 UTSW 15 99698803 unclassified probably benign
R6011:Asic1 UTSW 15 99699079 missense probably benign 0.05
R6383:Asic1 UTSW 15 99698880 missense probably damaging 0.96
R7133:Asic1 UTSW 15 99672087 missense probably damaging 1.00
R7255:Asic1 UTSW 15 99697457 missense probably damaging 0.97
R7587:Asic1 UTSW 15 99695590 missense probably damaging 1.00
R8030:Asic1 UTSW 15 99694841 missense possibly damaging 0.56
R8089:Asic1 UTSW 15 99698087 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGTAAGACTCCCAAGATCCATATC -3'
(R):5'- TACTCCCTGCAGACATAGGC -3'

Sequencing Primer
(F):5'- GATCCATATCTTGGCAGAGAAGTCC -3'
(R):5'- TGCAGACATAGGCAGGGACC -3'
Posted On2020-01-23