Incidental Mutation 'R8012:Asic1'
ID 616964
Institutional Source Beutler Lab
Gene Symbol Asic1
Ensembl Gene ENSMUSG00000023017
Gene Name acid-sensing ion channel 1
Synonyms B530003N02Rik, ASIC1 beta, Accn2, ASIC1b, ASIC, ASIC1a, BNaC2, ASICalpha
MMRRC Submission 046052-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.180) question?
Stock # R8012 (G1)
Quality Score 225.009
Status Validated
Chromosome 15
Chromosomal Location 99568249-99599011 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 99594532 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 326 (V326A)
Ref Sequence ENSEMBL: ENSMUSP00000023758 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023758] [ENSMUST00000228185]
AlphaFold Q6NXK8
Predicted Effect possibly damaging
Transcript: ENSMUST00000023758
AA Change: V326A

PolyPhen 2 Score 0.918 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000023758
Gene: ENSMUSG00000023017
AA Change: V326A

DomainStartEndE-ValueType
Pfam:ASC 21 454 9.9e-95 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000228185
AA Change: V359A

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
Meta Mutation Damage Score 0.2873 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the acid-sensing ion channel (ASIC) family of proteins, which are part of the degenerin/epithelial sodium channel (DEG/ENaC) superfamily. Members of the ASIC family are sensitive to amiloride and function in neurotransmission. The encoded proteins function in learning, pain transduction, touch sensation, and development of memory and fear. Alternatively spliced transcript variants have been described. [provided by RefSeq, Feb 2012]
PHENOTYPE: Homozygous mutation of this gene results in absence of H+-gated currents in hippocampal neurons, impaired long term potentiation, reduced excitatory postsynaptic potentials, and defective spatial learning and eye blink conditioning. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AAdacl4fm3 T A 4: 144,429,972 (GRCm39) D339V possibly damaging Het
Adam19 A G 11: 45,955,873 (GRCm39) E73G possibly damaging Het
Akap13 G A 7: 75,380,213 (GRCm39) R462H probably damaging Het
Alas1 A T 9: 106,123,962 (GRCm39) N65K probably benign Het
Amigo1 T A 3: 108,095,958 (GRCm39) S486T probably damaging Het
Arid1a A G 4: 133,420,174 (GRCm39) L591S unknown Het
Aspm A G 1: 139,385,202 (GRCm39) N282S probably benign Het
Atad5 A G 11: 79,985,066 (GRCm39) D51G probably damaging Het
Brd10 A G 19: 29,695,534 (GRCm39) S1320P possibly damaging Het
Cabp5 A T 7: 13,141,706 (GRCm39) probably null Het
Cdca2 A G 14: 67,914,821 (GRCm39) C813R probably benign Het
Chpf2 A T 5: 24,795,343 (GRCm39) R289W probably damaging Het
Csf1r A T 18: 61,250,136 (GRCm39) N367I possibly damaging Het
Cyp2c66 T C 19: 39,172,369 (GRCm39) F428S probably damaging Het
Dgkb A T 12: 38,189,485 (GRCm39) N296I probably benign Het
Dhcr24 T C 4: 106,443,853 (GRCm39) F481S probably damaging Het
Diaph3 T C 14: 87,274,958 (GRCm39) Y166C probably benign Het
Dnah7b A T 1: 46,282,525 (GRCm39) Q2886L probably damaging Het
Dock6 A T 9: 21,757,807 (GRCm39) V99E probably benign Het
F830045P16Rik T C 2: 129,316,352 (GRCm39) D119G possibly damaging Het
Fasn A T 11: 120,702,428 (GRCm39) L1773Q probably damaging Het
Filip1 A T 9: 79,725,241 (GRCm39) V1126E probably damaging Het
Fnta T C 8: 26,489,535 (GRCm39) I359V probably benign Het
Hoxc10 T C 15: 102,875,902 (GRCm39) S204P probably benign Het
Kif26b T C 1: 178,743,815 (GRCm39) C1304R probably benign Het
Lamc1 T C 1: 153,097,358 (GRCm39) E1562G probably benign Het
Lrguk A G 6: 34,033,038 (GRCm39) N235D probably benign Het
Ly6g6f T C 17: 35,300,060 (GRCm39) R263G possibly damaging Het
Mcrs1 C A 15: 99,147,766 (GRCm39) S47I probably damaging Het
Mx1 T A 16: 97,258,572 (GRCm39) I42F probably damaging Het
Nrp2 C T 1: 62,784,567 (GRCm39) R239C probably damaging Het
Nup188 T A 2: 30,227,277 (GRCm39) C1235S possibly damaging Het
Obsl1 T A 1: 75,469,317 (GRCm39) H1208L probably benign Het
Pcmt1 T C 10: 7,516,527 (GRCm39) D175G probably benign Het
Pcolce T C 5: 137,603,457 (GRCm39) K459E probably benign Het
Pudp T G 18: 50,701,310 (GRCm39) H141P possibly damaging Het
Rock2 T C 12: 16,992,743 (GRCm39) Y171H probably damaging Het
Rwdd1 A C 10: 33,885,198 (GRCm39) probably benign Het
Sbno1 A G 5: 124,522,565 (GRCm39) V1085A probably benign Het
Tie1 A G 4: 118,343,678 (GRCm39) L88P possibly damaging Het
Tmem131 T C 1: 36,847,045 (GRCm39) D1351G probably damaging Het
Tph1 A T 7: 46,306,303 (GRCm39) D219E probably damaging Het
Wdr86 A G 5: 24,935,177 (GRCm39) probably null Het
Other mutations in Asic1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01413:Asic1 APN 15 99,569,998 (GRCm39) missense probably damaging 0.99
IGL01418:Asic1 APN 15 99,569,998 (GRCm39) missense probably damaging 0.99
IGL01718:Asic1 APN 15 99,569,883 (GRCm39) missense probably damaging 1.00
IGL01941:Asic1 APN 15 99,596,982 (GRCm39) missense possibly damaging 0.95
IGL01993:Asic1 APN 15 99,595,353 (GRCm39) missense probably benign 0.01
IGL02097:Asic1 APN 15 99,592,567 (GRCm39) splice site probably benign
IGL03028:Asic1 APN 15 99,570,038 (GRCm39) missense probably benign 0.03
IGL03082:Asic1 APN 15 99,594,428 (GRCm39) missense probably benign
IGL03183:Asic1 APN 15 99,569,898 (GRCm39) missense probably benign 0.43
IGL03231:Asic1 APN 15 99,596,983 (GRCm39) missense probably benign 0.42
R0111:Asic1 UTSW 15 99,594,864 (GRCm39) missense probably damaging 1.00
R0243:Asic1 UTSW 15 99,596,498 (GRCm39) unclassified probably benign
R0316:Asic1 UTSW 15 99,569,819 (GRCm39) missense probably benign 0.03
R0518:Asic1 UTSW 15 99,596,700 (GRCm39) missense probably damaging 1.00
R0520:Asic1 UTSW 15 99,593,416 (GRCm39) missense probably damaging 1.00
R0521:Asic1 UTSW 15 99,596,700 (GRCm39) missense probably damaging 1.00
R0610:Asic1 UTSW 15 99,596,780 (GRCm39) missense probably benign 0.14
R1034:Asic1 UTSW 15 99,595,939 (GRCm39) missense probably damaging 1.00
R1666:Asic1 UTSW 15 99,597,006 (GRCm39) missense probably damaging 1.00
R1796:Asic1 UTSW 15 99,594,535 (GRCm39) missense probably null 0.99
R1993:Asic1 UTSW 15 99,569,765 (GRCm39) missense probably damaging 1.00
R2130:Asic1 UTSW 15 99,569,756 (GRCm39) missense possibly damaging 0.73
R2180:Asic1 UTSW 15 99,569,846 (GRCm39) missense probably benign
R2895:Asic1 UTSW 15 99,594,483 (GRCm39) missense probably benign 0.22
R3793:Asic1 UTSW 15 99,569,906 (GRCm39) nonsense probably null
R3848:Asic1 UTSW 15 99,570,814 (GRCm39) missense probably benign 0.01
R5115:Asic1 UTSW 15 99,569,933 (GRCm39) missense probably damaging 0.97
R5186:Asic1 UTSW 15 99,596,684 (GRCm39) unclassified probably benign
R5187:Asic1 UTSW 15 99,596,684 (GRCm39) unclassified probably benign
R5409:Asic1 UTSW 15 99,596,684 (GRCm39) unclassified probably benign
R6011:Asic1 UTSW 15 99,596,960 (GRCm39) missense probably benign 0.05
R6383:Asic1 UTSW 15 99,596,761 (GRCm39) missense probably damaging 0.96
R7133:Asic1 UTSW 15 99,569,968 (GRCm39) missense probably damaging 1.00
R7255:Asic1 UTSW 15 99,595,338 (GRCm39) missense probably damaging 0.97
R7587:Asic1 UTSW 15 99,593,471 (GRCm39) missense probably damaging 1.00
R8030:Asic1 UTSW 15 99,592,722 (GRCm39) missense possibly damaging 0.56
R8089:Asic1 UTSW 15 99,595,968 (GRCm39) missense probably damaging 1.00
R8919:Asic1 UTSW 15 99,569,826 (GRCm39) missense probably benign 0.40
R9417:Asic1 UTSW 15 99,590,405 (GRCm39) missense probably benign
R9534:Asic1 UTSW 15 99,594,397 (GRCm39) missense probably benign 0.01
R9646:Asic1 UTSW 15 99,593,414 (GRCm39) missense probably benign 0.17
R9717:Asic1 UTSW 15 99,590,657 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGTAAGACTCCCAAGATCCATATC -3'
(R):5'- TACTCCCTGCAGACATAGGC -3'

Sequencing Primer
(F):5'- GATCCATATCTTGGCAGAGAAGTCC -3'
(R):5'- TGCAGACATAGGCAGGGACC -3'
Posted On 2020-01-23