Incidental Mutation 'R8012:Csf1r'
ID616969
Institutional Source Beutler Lab
Gene Symbol Csf1r
Ensembl Gene ENSMUSG00000024621
Gene Namecolony stimulating factor 1 receptor
SynonymsFms, Fim-2, CD115, M-CSFR, CSF-1R, Csfmr
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.916) question?
Stock #R8012 (G1)
Quality Score225.009
Status Not validated
Chromosome18
Chromosomal Location61105572-61132149 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 61117064 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 367 (N367I)
Ref Sequence ENSEMBL: ENSMUSP00000025523 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025523] [ENSMUST00000115268]
Predicted Effect possibly damaging
Transcript: ENSMUST00000025523
AA Change: N367I

PolyPhen 2 Score 0.858 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000025523
Gene: ENSMUSG00000024621
AA Change: N367I

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IG 27 102 4.63e-8 SMART
IG 112 196 7.82e-6 SMART
IGc2 215 285 1.36e-5 SMART
IG 308 397 3.2e-2 SMART
IG_like 402 504 1.8e2 SMART
transmembrane domain 513 535 N/A INTRINSIC
TyrKc 580 908 1.45e-134 SMART
low complexity region 926 954 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000115268
AA Change: N367I

PolyPhen 2 Score 0.858 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000110923
Gene: ENSMUSG00000024621
AA Change: N367I

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IG 27 102 4.63e-8 SMART
IG 112 196 7.82e-6 SMART
IGc2 215 285 1.36e-5 SMART
IG 308 397 3.2e-2 SMART
IG_like 402 504 1.8e2 SMART
transmembrane domain 513 535 N/A INTRINSIC
TyrKc 580 908 1.45e-134 SMART
low complexity region 926 954 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is the receptor for colony stimulating factor 1, a cytokine which controls the production, differentiation, and function of macrophages. This receptor mediates most if not all of the biological effects of this cytokine. Ligand binding activates the receptor kinase through a process of oligomerization and transphosphorylation. The encoded protein is a tyrosine kinase transmembrane receptor and member of the CSF1/PDGF receptor family of tyrosine-protein kinases. Mutations in this gene have been associated with a predisposition to myeloid malignancy. The first intron of this gene contains a transcriptionally inactive ribosomal protein L7 processed pseudogene oriented in the opposite direction. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2013]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit skeletal, sensory, and reproductive abnormalities associated with severe deficiencies in osteoclasts, macrophages, and brain microglia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930021J03Rik A G 19: 29,718,134 S1320P possibly damaging Het
Adam19 A G 11: 46,065,046 E73G possibly damaging Het
Akap13 G A 7: 75,730,465 R462H probably damaging Het
Alas1 A T 9: 106,246,763 N65K probably benign Het
Amigo1 T A 3: 108,188,642 S486T probably damaging Het
Arid1a A G 4: 133,692,863 L591S unknown Het
Asic1 T C 15: 99,696,651 V326A possibly damaging Het
Aspm A G 1: 139,457,464 N282S probably benign Het
Atad5 A G 11: 80,094,240 D51G probably damaging Het
Cabp5 A T 7: 13,407,781 probably null Het
Cdca2 A G 14: 67,677,372 C813R probably benign Het
Chpf2 A T 5: 24,590,345 R289W probably damaging Het
Cyp2c66 T C 19: 39,183,925 F428S probably damaging Het
Dgkb A T 12: 38,139,486 N296I probably benign Het
Dhcr24 T C 4: 106,586,656 F481S probably damaging Het
Diaph3 T C 14: 87,037,522 Y166C probably benign Het
Dnah7b A T 1: 46,243,365 Q2886L probably damaging Het
Dock6 A T 9: 21,846,511 V99E probably benign Het
F830045P16Rik T C 2: 129,474,432 D119G possibly damaging Het
Fasn A T 11: 120,811,602 L1773Q probably damaging Het
Filip1 A T 9: 79,817,959 V1126E probably damaging Het
Fnta T C 8: 25,999,507 I359V probably benign Het
Gm13178 T A 4: 144,703,402 D339V possibly damaging Het
Hoxc10 T C 15: 102,967,467 S204P probably benign Het
Kif26b T C 1: 178,916,250 C1304R probably benign Het
Lamc1 T C 1: 153,221,612 E1562G probably benign Het
Lrguk A G 6: 34,056,103 N235D probably benign Het
Ly6g6f T C 17: 35,081,084 R263G possibly damaging Het
Mcrs1 C A 15: 99,249,885 S47I probably damaging Het
Mx1 T A 16: 97,457,372 I42F probably damaging Het
Nrp2 C T 1: 62,745,408 R239C probably damaging Het
Nup188 T A 2: 30,337,265 C1235S possibly damaging Het
Obsl1 T A 1: 75,492,673 H1208L probably benign Het
Pcmt1 T C 10: 7,640,763 D175G probably benign Het
Pcolce T C 5: 137,605,195 K459E probably benign Het
Pudp T G 18: 50,568,239 H141P possibly damaging Het
Rock2 T C 12: 16,942,742 Y171H probably damaging Het
Sbno1 A G 5: 124,384,502 V1085A probably benign Het
Tie1 A G 4: 118,486,481 L88P possibly damaging Het
Tmem131 T C 1: 36,807,964 D1351G probably damaging Het
Tph1 A T 7: 46,656,879 D219E probably damaging Het
Wdr86 A G 5: 24,730,179 probably null Het
Other mutations in Csf1r
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01403:Csf1r APN 18 61114825 missense probably benign 0.08
IGL01603:Csf1r APN 18 61129301 missense probably damaging 1.00
IGL02377:Csf1r APN 18 61124468 splice site probably benign
IGL03000:Csf1r APN 18 61109652 missense probably damaging 0.97
IGL03011:Csf1r APN 18 61110401 missense probably benign 0.00
IGL03132:Csf1r APN 18 61128099 missense probably benign 0.03
IGL03189:Csf1r APN 18 61105986 missense probably benign 0.05
IGL03224:Csf1r APN 18 61112062 missense probably damaging 0.96
IGL03351:Csf1r APN 18 61117108 nonsense probably null
ANU74:Csf1r UTSW 18 61117391 missense probably benign 0.09
R1245:Csf1r UTSW 18 61114812 missense probably benign
R1363:Csf1r UTSW 18 61124845 missense possibly damaging 0.95
R1651:Csf1r UTSW 18 61110401 missense possibly damaging 0.64
R1785:Csf1r UTSW 18 61129077 missense probably damaging 0.98
R1786:Csf1r UTSW 18 61129077 missense probably damaging 0.98
R1902:Csf1r UTSW 18 61130141 missense probably damaging 0.99
R1968:Csf1r UTSW 18 61112795 missense probably benign 0.00
R2177:Csf1r UTSW 18 61114943 splice site probably benign
R3743:Csf1r UTSW 18 61114774 missense probably benign 0.01
R3809:Csf1r UTSW 18 61112764 missense probably benign 0.22
R4374:Csf1r UTSW 18 61119006 missense probably damaging 0.99
R4683:Csf1r UTSW 18 61124911 missense probably damaging 1.00
R4973:Csf1r UTSW 18 61129047 missense probably damaging 1.00
R5080:Csf1r UTSW 18 61124301 missense probably damaging 1.00
R5314:Csf1r UTSW 18 61129724 missense probably damaging 1.00
R5936:Csf1r UTSW 18 61125808 missense probably damaging 1.00
R6015:Csf1r UTSW 18 61109712 missense possibly damaging 0.50
R6227:Csf1r UTSW 18 61125828 nonsense probably null
R6505:Csf1r UTSW 18 61129733 missense probably damaging 1.00
R6602:Csf1r UTSW 18 61110425 missense possibly damaging 0.81
R6811:Csf1r UTSW 18 61119053 missense probably damaging 1.00
R6813:Csf1r UTSW 18 61112734 missense probably benign
R7218:Csf1r UTSW 18 61130324 missense probably damaging 1.00
R7480:Csf1r UTSW 18 61117538 missense probably benign 0.06
R7752:Csf1r UTSW 18 61110296 missense probably damaging 1.00
R7762:Csf1r UTSW 18 61110500 missense probably benign 0.01
R7901:Csf1r UTSW 18 61110296 missense probably damaging 1.00
R7984:Csf1r UTSW 18 61110296 missense probably damaging 1.00
R8043:Csf1r UTSW 18 61124875 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATAAACCTCTTGGGGCAGG -3'
(R):5'- GGTCTCAGTCTCTTGACCAC -3'

Sequencing Primer
(F):5'- TACTCTTAGATGAGAGGACAGAGGTG -3'
(R):5'- GACCACCTGCCCTGCTAC -3'
Posted On2020-01-23