Incidental Mutation 'R8013:Disp2'
ID616978
Institutional Source Beutler Lab
Gene Symbol Disp2
Ensembl Gene ENSMUSG00000040035
Gene Namedispatched RND tramsporter family member 2
SynonymsB230210L08Rik, DispB
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.853) question?
Stock #R8013 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location118779719-118811293 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 118789682 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 298 (Y298*)
Ref Sequence ENSEMBL: ENSMUSP00000037136 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037547] [ENSMUST00000063975] [ENSMUST00000110843] [ENSMUST00000110846]
Predicted Effect probably null
Transcript: ENSMUST00000037547
AA Change: Y298*
SMART Domains Protein: ENSMUSP00000037136
Gene: ENSMUSG00000040035
AA Change: Y298*

DomainStartEndE-ValueType
transmembrane domain 123 145 N/A INTRINSIC
low complexity region 195 203 N/A INTRINSIC
Pfam:MMPL 435 635 9.7e-8 PFAM
Pfam:Sterol-sensing 458 611 9.1e-9 PFAM
transmembrane domain 657 679 N/A INTRINSIC
low complexity region 682 695 N/A INTRINSIC
low complexity region 748 761 N/A INTRINSIC
transmembrane domain 914 936 N/A INTRINSIC
transmembrane domain 943 965 N/A INTRINSIC
transmembrane domain 975 997 N/A INTRINSIC
transmembrane domain 1018 1040 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000063975
SMART Domains Protein: ENSMUSP00000070031
Gene: ENSMUSG00000040035

DomainStartEndE-ValueType
transmembrane domain 123 145 N/A INTRINSIC
low complexity region 195 203 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110843
SMART Domains Protein: ENSMUSP00000106467
Gene: ENSMUSG00000040035

DomainStartEndE-ValueType
transmembrane domain 123 145 N/A INTRINSIC
low complexity region 195 203 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110846
SMART Domains Protein: ENSMUSP00000106470
Gene: ENSMUSG00000040035

DomainStartEndE-ValueType
transmembrane domain 123 145 N/A INTRINSIC
low complexity region 195 203 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: The pattern of cellular proliferation and differentiation that leads to normal development of embryonic structures often depends upon the localized production of secreted protein signals. Cells surrounding the source of a particular signal respond in a graded manner according to the effective concentration of the signal, and this response produces the pattern of cell types constituting the mature structure. A segment-polarity gene known as dispatched has been identified in Drosophila and its protein product is required for normal Hedgehog (Hh) signaling. [provided by RefSeq, Sep 2015]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik T G 6: 149,328,870 V1138G probably damaging Het
6030458C11Rik C A 15: 12,824,529 D7Y probably benign Het
9530053A07Rik G A 7: 28,137,541 R295H probably benign Het
Ahnak A G 19: 9,009,335 D2661G unknown Het
Akap13 G A 7: 75,730,465 R462H probably damaging Het
Apob T A 12: 8,010,798 N3093K possibly damaging Het
Baz2a C T 10: 128,125,288 R1627C probably benign Het
Baz2a T G 10: 128,125,292 V1628G possibly damaging Het
Bbs7 A T 3: 36,594,387 I404K probably damaging Het
BC030867 A G 11: 102,257,899 N379D probably benign Het
Cacna1g T C 11: 94,456,970 Y764C probably damaging Het
Casr G A 16: 36,509,644 L443F probably benign Het
Cfap43 T A 19: 47,773,109 I849F probably damaging Het
Cntn3 A T 6: 102,199,317 H812Q probably benign Het
Cog1 A G 11: 113,656,164 D528G probably damaging Het
Depdc5 C T 5: 32,973,842 T1229M probably benign Het
Dis3 T A 14: 99,077,399 R954W possibly damaging Het
Dock2 A C 11: 34,705,850 I393S probably damaging Het
Dtd1 A G 2: 144,617,332 D92G probably damaging Het
Eef2 T A 10: 81,178,196 V121D probably damaging Het
Eml1 T A 12: 108,521,679 I550N probably benign Het
Entpd7 A G 19: 43,728,055 D496G probably benign Het
Ets2 T A 16: 95,716,100 L292Q probably damaging Het
Ext1 T C 15: 53,075,887 I589V possibly damaging Het
Fam20a T A 11: 109,685,506 E142D possibly damaging Het
Farp1 T A 14: 121,242,401 I368N probably damaging Het
Fars2 C T 13: 36,205,085 Q186* probably null Het
Fbn2 T C 18: 58,104,081 T617A possibly damaging Het
Fbxo38 T C 18: 62,530,811 E203G possibly damaging Het
Fhdc1 A T 3: 84,474,639 M1K probably null Het
Gatad1 T C 5: 3,643,540 R210G probably benign Het
Gm28363 A G 1: 117,726,804 R58G probably benign Het
Gm8356 A T 14: 6,536,303 N58K probably damaging Het
Grsf1 A G 5: 88,675,756 probably null Het
Hephl1 T A 9: 15,054,609 D1016V possibly damaging Het
Kcnma1 T A 14: 23,373,143 I831F probably benign Het
Krt78 T C 15: 101,948,542 R377G probably damaging Het
Lama2 T C 10: 27,344,498 H457R probably benign Het
Lmnb1 T A 18: 56,708,359 Y83N probably damaging Het
Loxl4 A G 19: 42,607,676 C113R probably damaging Het
Lrba A T 3: 86,417,971 D1912V probably damaging Het
Macf1 T A 4: 123,526,826 T212S probably benign Het
Map3k4 A T 17: 12,271,031 C504* probably null Het
Map4k4 T C 1: 39,962,212 I53T unknown Het
Myo5b C T 18: 74,760,899 Q1700* probably null Het
Npas2 T C 1: 39,338,065 F503L probably benign Het
Nrg1 A T 8: 31,949,923 S149T probably benign Het
Olfr1243 A G 2: 89,527,936 V158A probably benign Het
Olfr155 T A 4: 43,854,958 F216L probably benign Het
Olfr697 C T 7: 106,741,617 V106I probably benign Het
Olfr824 T A 10: 130,126,778 K93M probably damaging Het
Pdia6 T C 12: 17,273,965 L66S probably damaging Het
Prss35 T C 9: 86,755,425 S83P probably damaging Het
Psme4 G A 11: 30,804,320 M192I probably benign Het
Ptprs A C 17: 56,435,994 S383A probably damaging Het
Sar1b C T 11: 51,779,794 P55L possibly damaging Het
Sgsh A G 11: 119,352,695 V67A probably damaging Het
Slc16a4 A G 3: 107,311,478 Y465C probably damaging Het
Soga1 A G 2: 157,030,786 probably null Het
Stard9 T C 2: 120,688,101 I502T probably damaging Het
Sugp2 T A 8: 70,251,642 Y610N probably damaging Het
Tbc1d24 G A 17: 24,182,821 P385S possibly damaging Het
Tm4sf1 T C 3: 57,292,898 I99V probably benign Het
Tpr G T 1: 150,398,608 V163L probably benign Het
Usp31 T C 7: 121,649,257 S988G probably damaging Het
Wdr63 T C 3: 146,081,285 T332A probably damaging Het
Zbtb26 T A 2: 37,437,001 probably null Het
Zfp536 T C 7: 37,569,610 N127S probably damaging Het
Zfp750 T A 11: 121,513,017 D344V possibly damaging Het
Zmym5 T A 14: 56,794,426 K408N possibly damaging Het
Other mutations in Disp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00790:Disp2 APN 2 118786278 missense probably damaging 1.00
IGL00970:Disp2 APN 2 118791793 missense probably damaging 1.00
IGL01790:Disp2 APN 2 118790880 missense probably damaging 1.00
IGL01809:Disp2 APN 2 118787264 splice site probably benign
IGL02069:Disp2 APN 2 118790680 missense possibly damaging 0.93
IGL02140:Disp2 APN 2 118790869 missense probably benign
IGL02143:Disp2 APN 2 118789969 missense probably damaging 1.00
IGL02155:Disp2 APN 2 118791804 missense probably damaging 1.00
IGL02884:Disp2 APN 2 118787551 splice site probably benign
IGL03113:Disp2 APN 2 118790778 unclassified probably null
IGL03194:Disp2 APN 2 118787629 missense probably damaging 1.00
PIT4453001:Disp2 UTSW 2 118787644 missense probably benign 0.01
R0109:Disp2 UTSW 2 118791816 missense probably damaging 1.00
R0126:Disp2 UTSW 2 118790338 missense probably damaging 1.00
R0603:Disp2 UTSW 2 118792006 missense probably damaging 1.00
R0610:Disp2 UTSW 2 118792236 missense probably benign 0.02
R0639:Disp2 UTSW 2 118790844 missense possibly damaging 0.74
R0673:Disp2 UTSW 2 118790844 missense possibly damaging 0.74
R0755:Disp2 UTSW 2 118789762 missense probably benign 0.00
R0781:Disp2 UTSW 2 118790439 missense probably damaging 1.00
R1110:Disp2 UTSW 2 118790439 missense probably damaging 1.00
R1148:Disp2 UTSW 2 118806418 critical splice donor site probably null
R1148:Disp2 UTSW 2 118806418 critical splice donor site probably null
R1243:Disp2 UTSW 2 118791822 missense probably damaging 1.00
R1587:Disp2 UTSW 2 118791583 missense probably damaging 1.00
R1739:Disp2 UTSW 2 118791550 missense probably damaging 1.00
R1771:Disp2 UTSW 2 118791297 nonsense probably null
R1781:Disp2 UTSW 2 118792561 missense probably damaging 0.96
R1918:Disp2 UTSW 2 118791927 missense probably benign
R1956:Disp2 UTSW 2 118792223 missense probably benign 0.02
R2167:Disp2 UTSW 2 118791685 missense probably damaging 1.00
R2206:Disp2 UTSW 2 118792244 missense probably benign 0.02
R4031:Disp2 UTSW 2 118791880 missense probably benign 0.27
R4617:Disp2 UTSW 2 118790162 missense probably benign
R4656:Disp2 UTSW 2 118790563 missense probably damaging 1.00
R4684:Disp2 UTSW 2 118792756 missense probably damaging 1.00
R4696:Disp2 UTSW 2 118791684 nonsense probably null
R4697:Disp2 UTSW 2 118791684 nonsense probably null
R4738:Disp2 UTSW 2 118790326 missense probably damaging 0.97
R4834:Disp2 UTSW 2 118792504 missense probably benign 0.09
R4914:Disp2 UTSW 2 118790454 missense probably damaging 0.99
R4915:Disp2 UTSW 2 118790454 missense probably damaging 0.99
R4918:Disp2 UTSW 2 118790454 missense probably damaging 0.99
R5045:Disp2 UTSW 2 118792062 missense probably benign 0.03
R5208:Disp2 UTSW 2 118791805 missense probably damaging 1.00
R5303:Disp2 UTSW 2 118810848 unclassified probably benign
R5350:Disp2 UTSW 2 118787575 missense probably benign 0.23
R5355:Disp2 UTSW 2 118786911 missense probably benign 0.00
R6011:Disp2 UTSW 2 118790820 missense possibly damaging 0.65
R6031:Disp2 UTSW 2 118789794 missense probably benign 0.01
R6031:Disp2 UTSW 2 118789794 missense probably benign 0.01
R6139:Disp2 UTSW 2 118790662 missense probably damaging 0.97
R6169:Disp2 UTSW 2 118791550 missense probably damaging 1.00
R6187:Disp2 UTSW 2 118792143 missense probably damaging 1.00
R6209:Disp2 UTSW 2 118786921 missense probably damaging 1.00
R6250:Disp2 UTSW 2 118790766 missense probably damaging 1.00
R6392:Disp2 UTSW 2 118790749 missense probably damaging 1.00
R7138:Disp2 UTSW 2 118786880 missense probably benign
R7156:Disp2 UTSW 2 118791811 missense probably damaging 1.00
R7230:Disp2 UTSW 2 118791805 missense probably damaging 1.00
R7400:Disp2 UTSW 2 118791886 missense probably damaging 1.00
R7460:Disp2 UTSW 2 118789780 missense probably damaging 1.00
R7505:Disp2 UTSW 2 118791088 missense probably damaging 1.00
R7542:Disp2 UTSW 2 118791118 missense probably damaging 0.97
R7728:Disp2 UTSW 2 118791480 missense probably benign 0.31
R7757:Disp2 UTSW 2 118790910 missense probably damaging 1.00
R7798:Disp2 UTSW 2 118791879 missense probably benign
R8085:Disp2 UTSW 2 118786971 missense possibly damaging 0.94
R8179:Disp2 UTSW 2 118792549 missense probably damaging 0.99
R8288:Disp2 UTSW 2 118790281 missense probably damaging 1.00
Z1177:Disp2 UTSW 2 118789702 missense probably damaging 0.99
Z1177:Disp2 UTSW 2 118790827 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCAAAATACTTGCTCTCTGCC -3'
(R):5'- CGTTGCTTCCGGTACACTTG -3'

Sequencing Primer
(F):5'- CCCTTCAGCATGACAAGAGGTG -3'
(R):5'- CGGTACACTTGGCAGGAACTTG -3'
Posted On2020-01-23