Incidental Mutation 'R8013:Fhdc1'
ID616984
Institutional Source Beutler Lab
Gene Symbol Fhdc1
Ensembl Gene ENSMUSG00000041842
Gene NameFH2 domain containing 1
Synonyms6330505N24Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.346) question?
Stock #R8013 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location84442198-84480429 bp(-) (GRCm38)
Type of Mutationstart codon destroyed
DNA Base Change (assembly) A to T at 84474639 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 1 (M1K)
Ref Sequence ENSEMBL: ENSMUSP00000088525 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091002] [ENSMUST00000107689] [ENSMUST00000194027]
Predicted Effect probably null
Transcript: ENSMUST00000091002
AA Change: M1K

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000088525
Gene: ENSMUSG00000041842
AA Change: M1K

DomainStartEndE-ValueType
low complexity region 30 48 N/A INTRINSIC
low complexity region 55 82 N/A INTRINSIC
FH2 88 538 5.13e-57 SMART
Blast:FH2 539 571 6e-6 BLAST
low complexity region 789 822 N/A INTRINSIC
low complexity region 962 976 N/A INTRINSIC
low complexity region 1009 1026 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000107689
AA Change: M1K

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000103317
Gene: ENSMUSG00000041842
AA Change: M1K

DomainStartEndE-ValueType
low complexity region 30 48 N/A INTRINSIC
low complexity region 55 82 N/A INTRINSIC
FH2 88 538 5.13e-57 SMART
Blast:FH2 539 571 6e-6 BLAST
low complexity region 789 822 N/A INTRINSIC
low complexity region 962 976 N/A INTRINSIC
low complexity region 1009 1026 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000194027
SMART Domains Protein: ENSMUSP00000142030
Gene: ENSMUSG00000041842

DomainStartEndE-ValueType
Pfam:FH2 1 145 3.8e-22 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik T G 6: 149,328,870 V1138G probably damaging Het
6030458C11Rik C A 15: 12,824,529 D7Y probably benign Het
9530053A07Rik G A 7: 28,137,541 R295H probably benign Het
Ahnak A G 19: 9,009,335 D2661G unknown Het
Akap13 G A 7: 75,730,465 R462H probably damaging Het
Apob T A 12: 8,010,798 N3093K possibly damaging Het
Baz2a C T 10: 128,125,288 R1627C probably benign Het
Baz2a T G 10: 128,125,292 V1628G possibly damaging Het
Bbs7 A T 3: 36,594,387 I404K probably damaging Het
BC030867 A G 11: 102,257,899 N379D probably benign Het
Cacna1g T C 11: 94,456,970 Y764C probably damaging Het
Casr G A 16: 36,509,644 L443F probably benign Het
Cfap43 T A 19: 47,773,109 I849F probably damaging Het
Cntn3 A T 6: 102,199,317 H812Q probably benign Het
Cog1 A G 11: 113,656,164 D528G probably damaging Het
Depdc5 C T 5: 32,973,842 T1229M probably benign Het
Dis3 T A 14: 99,077,399 R954W possibly damaging Het
Disp2 T A 2: 118,789,682 Y298* probably null Het
Dock2 A C 11: 34,705,850 I393S probably damaging Het
Dtd1 A G 2: 144,617,332 D92G probably damaging Het
Eef2 T A 10: 81,178,196 V121D probably damaging Het
Eml1 T A 12: 108,521,679 I550N probably benign Het
Entpd7 A G 19: 43,728,055 D496G probably benign Het
Ets2 T A 16: 95,716,100 L292Q probably damaging Het
Ext1 T C 15: 53,075,887 I589V possibly damaging Het
Fam20a T A 11: 109,685,506 E142D possibly damaging Het
Farp1 T A 14: 121,242,401 I368N probably damaging Het
Fars2 C T 13: 36,205,085 Q186* probably null Het
Fbn2 T C 18: 58,104,081 T617A possibly damaging Het
Fbxo38 T C 18: 62,530,811 E203G possibly damaging Het
Gatad1 T C 5: 3,643,540 R210G probably benign Het
Gm28363 A G 1: 117,726,804 R58G probably benign Het
Gm8356 A T 14: 6,536,303 N58K probably damaging Het
Grsf1 A G 5: 88,675,756 probably null Het
Hephl1 T A 9: 15,054,609 D1016V possibly damaging Het
Kcnma1 T A 14: 23,373,143 I831F probably benign Het
Krt78 T C 15: 101,948,542 R377G probably damaging Het
Lama2 T C 10: 27,344,498 H457R probably benign Het
Lmnb1 T A 18: 56,708,359 Y83N probably damaging Het
Loxl4 A G 19: 42,607,676 C113R probably damaging Het
Lrba A T 3: 86,417,971 D1912V probably damaging Het
Macf1 T A 4: 123,526,826 T212S probably benign Het
Map3k4 A T 17: 12,271,031 C504* probably null Het
Map4k4 T C 1: 39,962,212 I53T unknown Het
Myo5b C T 18: 74,760,899 Q1700* probably null Het
Npas2 T C 1: 39,338,065 F503L probably benign Het
Nrg1 A T 8: 31,949,923 S149T probably benign Het
Olfr1243 A G 2: 89,527,936 V158A probably benign Het
Olfr155 T A 4: 43,854,958 F216L probably benign Het
Olfr697 C T 7: 106,741,617 V106I probably benign Het
Olfr824 T A 10: 130,126,778 K93M probably damaging Het
Pdia6 T C 12: 17,273,965 L66S probably damaging Het
Prss35 T C 9: 86,755,425 S83P probably damaging Het
Psme4 G A 11: 30,804,320 M192I probably benign Het
Ptprs A C 17: 56,435,994 S383A probably damaging Het
Sar1b C T 11: 51,779,794 P55L possibly damaging Het
Sgsh A G 11: 119,352,695 V67A probably damaging Het
Slc16a4 A G 3: 107,311,478 Y465C probably damaging Het
Soga1 A G 2: 157,030,786 probably null Het
Stard9 T C 2: 120,688,101 I502T probably damaging Het
Sugp2 T A 8: 70,251,642 Y610N probably damaging Het
Tbc1d24 G A 17: 24,182,821 P385S possibly damaging Het
Tm4sf1 T C 3: 57,292,898 I99V probably benign Het
Tpr G T 1: 150,398,608 V163L probably benign Het
Usp31 T C 7: 121,649,257 S988G probably damaging Het
Wdr63 T C 3: 146,081,285 T332A probably damaging Het
Zbtb26 T A 2: 37,437,001 probably null Het
Zfp536 T C 7: 37,569,610 N127S probably damaging Het
Zfp750 T A 11: 121,513,017 D344V possibly damaging Het
Zmym5 T A 14: 56,794,426 K408N possibly damaging Het
Other mutations in Fhdc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00507:Fhdc1 APN 3 84448800 missense probably damaging 1.00
IGL00556:Fhdc1 APN 3 84457242 missense possibly damaging 0.81
IGL00951:Fhdc1 APN 3 84464313 missense possibly damaging 0.90
IGL01744:Fhdc1 APN 3 84444735 missense possibly damaging 0.66
IGL01754:Fhdc1 APN 3 84444735 missense possibly damaging 0.66
IGL01762:Fhdc1 APN 3 84444735 missense possibly damaging 0.66
IGL01764:Fhdc1 APN 3 84444735 missense possibly damaging 0.66
IGL01769:Fhdc1 APN 3 84444735 missense possibly damaging 0.66
IGL01778:Fhdc1 APN 3 84444735 missense possibly damaging 0.66
IGL01779:Fhdc1 APN 3 84444735 missense possibly damaging 0.66
IGL01781:Fhdc1 APN 3 84444735 missense possibly damaging 0.66
IGL02243:Fhdc1 APN 3 84474640 start codon destroyed possibly damaging 0.89
IGL02260:Fhdc1 APN 3 84444735 missense possibly damaging 0.66
IGL02261:Fhdc1 APN 3 84444735 missense possibly damaging 0.66
IGL02266:Fhdc1 APN 3 84444735 missense possibly damaging 0.66
IGL02271:Fhdc1 APN 3 84444735 missense possibly damaging 0.66
IGL02284:Fhdc1 APN 3 84444735 missense possibly damaging 0.66
IGL02292:Fhdc1 APN 3 84444735 missense possibly damaging 0.66
IGL02296:Fhdc1 APN 3 84444735 missense possibly damaging 0.66
IGL02301:Fhdc1 APN 3 84444735 missense possibly damaging 0.66
IGL02347:Fhdc1 APN 3 84444735 missense possibly damaging 0.66
IGL02416:Fhdc1 APN 3 84445228 missense probably benign 0.03
IGL03189:Fhdc1 APN 3 84455061 intron probably benign
IGL03392:Fhdc1 APN 3 84444519 missense possibly damaging 0.55
R0125:Fhdc1 UTSW 3 84445545 missense probably benign
R0135:Fhdc1 UTSW 3 84445618 missense probably damaging 0.97
R0255:Fhdc1 UTSW 3 84453510 intron probably benign
R0401:Fhdc1 UTSW 3 84444624 missense probably benign 0.02
R1371:Fhdc1 UTSW 3 84445003 missense probably damaging 1.00
R1727:Fhdc1 UTSW 3 84446176 missense possibly damaging 0.50
R1769:Fhdc1 UTSW 3 84448778 missense probably damaging 1.00
R1781:Fhdc1 UTSW 3 84448804 missense probably damaging 0.99
R1840:Fhdc1 UTSW 3 84445821 missense possibly damaging 0.46
R1970:Fhdc1 UTSW 3 84454851 missense probably damaging 1.00
R2038:Fhdc1 UTSW 3 84444561 missense probably benign 0.22
R2088:Fhdc1 UTSW 3 84474726 start gained probably benign
R2256:Fhdc1 UTSW 3 84446046 missense probably benign
R2939:Fhdc1 UTSW 3 84457270 missense possibly damaging 0.47
R3813:Fhdc1 UTSW 3 84464270 critical splice donor site probably null
R4022:Fhdc1 UTSW 3 84445102 missense probably benign 0.01
R4175:Fhdc1 UTSW 3 84456987 intron probably benign
R4243:Fhdc1 UTSW 3 84444826 missense probably benign 0.42
R4245:Fhdc1 UTSW 3 84444826 missense probably benign 0.42
R4290:Fhdc1 UTSW 3 84444826 missense probably benign 0.42
R4291:Fhdc1 UTSW 3 84444826 missense probably benign 0.42
R4292:Fhdc1 UTSW 3 84444826 missense probably benign 0.42
R4293:Fhdc1 UTSW 3 84444826 missense probably benign 0.42
R4294:Fhdc1 UTSW 3 84444826 missense probably benign 0.42
R4295:Fhdc1 UTSW 3 84444826 missense probably benign 0.42
R4334:Fhdc1 UTSW 3 84444826 missense probably benign 0.42
R4335:Fhdc1 UTSW 3 84444826 missense probably benign 0.42
R4342:Fhdc1 UTSW 3 84444826 missense probably benign 0.42
R4344:Fhdc1 UTSW 3 84444826 missense probably benign 0.42
R4354:Fhdc1 UTSW 3 84444826 missense probably benign 0.42
R4550:Fhdc1 UTSW 3 84445176 missense probably benign 0.16
R4626:Fhdc1 UTSW 3 84474250 missense probably damaging 1.00
R4925:Fhdc1 UTSW 3 84453533 missense probably damaging 1.00
R5155:Fhdc1 UTSW 3 84446150 missense probably benign 0.00
R5588:Fhdc1 UTSW 3 84465476 missense possibly damaging 0.91
R6043:Fhdc1 UTSW 3 84448886 missense probably damaging 0.96
R6063:Fhdc1 UTSW 3 84446029 missense probably benign 0.00
R6652:Fhdc1 UTSW 3 84464324 missense probably damaging 1.00
R6706:Fhdc1 UTSW 3 84446422 missense probably damaging 1.00
R6783:Fhdc1 UTSW 3 84445527 missense probably benign 0.00
R6984:Fhdc1 UTSW 3 84444516 missense possibly damaging 0.93
R7182:Fhdc1 UTSW 3 84448850 missense probably damaging 0.98
R7299:Fhdc1 UTSW 3 84444540 missense probably damaging 1.00
R7574:Fhdc1 UTSW 3 84446131 missense probably benign
R7765:Fhdc1 UTSW 3 84444599 missense probably benign 0.04
R8014:Fhdc1 UTSW 3 84474639 start codon destroyed probably null 0.99
R8139:Fhdc1 UTSW 3 84451483 missense probably damaging 1.00
R8264:Fhdc1 UTSW 3 84455032 missense probably damaging 1.00
R8384:Fhdc1 UTSW 3 84454999 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- AGGGAGCTGTAGCCATTCAG -3'
(R):5'- GTGAGAACAGTTACCAGCACTG -3'

Sequencing Primer
(F):5'- CTGTAGCCATTCAGGTAAGAAACTG -3'
(R):5'- CAGCACTGACTTTAAACTACTTGC -3'
Posted On2020-01-23