Incidental Mutation 'R8013:Olfr155'
ID616988
Institutional Source Beutler Lab
Gene Symbol Olfr155
Ensembl Gene ENSMUSG00000071000
Gene Nameolfactory receptor 155
SynonymsOR37A, Olfr37a, GA_x6K02T2N78B-16092200-16091241, mOR37a, MOR262-14
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock #R8013 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location43851565-43857595 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 43854958 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 216 (F216L)
Ref Sequence ENSEMBL: ENSMUSP00000103492 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095108] [ENSMUST00000107860]
Predicted Effect probably benign
Transcript: ENSMUST00000095108
AA Change: F216L

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000092726
Gene: ENSMUSG00000071000
AA Change: F216L

DomainStartEndE-ValueType
Pfam:7tm_1 42 297 2.8e-35 PFAM
Pfam:7tm_4 140 290 1.4e-45 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107860
AA Change: F216L

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000103492
Gene: ENSMUSG00000071000
AA Change: F216L

DomainStartEndE-ValueType
Pfam:7tm_4 32 315 9.7e-59 PFAM
Pfam:7tm_1 42 297 3.5e-25 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik T G 6: 149,328,870 V1138G probably damaging Het
6030458C11Rik C A 15: 12,824,529 D7Y probably benign Het
9530053A07Rik G A 7: 28,137,541 R295H probably benign Het
Ahnak A G 19: 9,009,335 D2661G unknown Het
Akap13 G A 7: 75,730,465 R462H probably damaging Het
Apob T A 12: 8,010,798 N3093K possibly damaging Het
Baz2a C T 10: 128,125,288 R1627C probably benign Het
Baz2a T G 10: 128,125,292 V1628G possibly damaging Het
Bbs7 A T 3: 36,594,387 I404K probably damaging Het
BC030867 A G 11: 102,257,899 N379D probably benign Het
Cacna1g T C 11: 94,456,970 Y764C probably damaging Het
Casr G A 16: 36,509,644 L443F probably benign Het
Cfap43 T A 19: 47,773,109 I849F probably damaging Het
Cntn3 A T 6: 102,199,317 H812Q probably benign Het
Cog1 A G 11: 113,656,164 D528G probably damaging Het
Depdc5 C T 5: 32,973,842 T1229M probably benign Het
Dis3 T A 14: 99,077,399 R954W possibly damaging Het
Disp2 T A 2: 118,789,682 Y298* probably null Het
Dock2 A C 11: 34,705,850 I393S probably damaging Het
Dtd1 A G 2: 144,617,332 D92G probably damaging Het
Eef2 T A 10: 81,178,196 V121D probably damaging Het
Eml1 T A 12: 108,521,679 I550N probably benign Het
Entpd7 A G 19: 43,728,055 D496G probably benign Het
Ets2 T A 16: 95,716,100 L292Q probably damaging Het
Ext1 T C 15: 53,075,887 I589V possibly damaging Het
Fam20a T A 11: 109,685,506 E142D possibly damaging Het
Farp1 T A 14: 121,242,401 I368N probably damaging Het
Fars2 C T 13: 36,205,085 Q186* probably null Het
Fbn2 T C 18: 58,104,081 T617A possibly damaging Het
Fbxo38 T C 18: 62,530,811 E203G possibly damaging Het
Fhdc1 A T 3: 84,474,639 M1K probably null Het
Gatad1 T C 5: 3,643,540 R210G probably benign Het
Gm28363 A G 1: 117,726,804 R58G probably benign Het
Gm8356 A T 14: 6,536,303 N58K probably damaging Het
Grsf1 A G 5: 88,675,756 probably null Het
Hephl1 T A 9: 15,054,609 D1016V possibly damaging Het
Kcnma1 T A 14: 23,373,143 I831F probably benign Het
Krt78 T C 15: 101,948,542 R377G probably damaging Het
Lama2 T C 10: 27,344,498 H457R probably benign Het
Lmnb1 T A 18: 56,708,359 Y83N probably damaging Het
Loxl4 A G 19: 42,607,676 C113R probably damaging Het
Lrba A T 3: 86,417,971 D1912V probably damaging Het
Macf1 T A 4: 123,526,826 T212S probably benign Het
Map3k4 A T 17: 12,271,031 C504* probably null Het
Map4k4 T C 1: 39,962,212 I53T unknown Het
Myo5b C T 18: 74,760,899 Q1700* probably null Het
Npas2 T C 1: 39,338,065 F503L probably benign Het
Nrg1 A T 8: 31,949,923 S149T probably benign Het
Olfr1243 A G 2: 89,527,936 V158A probably benign Het
Olfr697 C T 7: 106,741,617 V106I probably benign Het
Olfr824 T A 10: 130,126,778 K93M probably damaging Het
Pdia6 T C 12: 17,273,965 L66S probably damaging Het
Prss35 T C 9: 86,755,425 S83P probably damaging Het
Psme4 G A 11: 30,804,320 M192I probably benign Het
Ptprs A C 17: 56,435,994 S383A probably damaging Het
Sar1b C T 11: 51,779,794 P55L possibly damaging Het
Sgsh A G 11: 119,352,695 V67A probably damaging Het
Slc16a4 A G 3: 107,311,478 Y465C probably damaging Het
Soga1 A G 2: 157,030,786 probably null Het
Stard9 T C 2: 120,688,101 I502T probably damaging Het
Sugp2 T A 8: 70,251,642 Y610N probably damaging Het
Tbc1d24 G A 17: 24,182,821 P385S possibly damaging Het
Tm4sf1 T C 3: 57,292,898 I99V probably benign Het
Tpr G T 1: 150,398,608 V163L probably benign Het
Usp31 T C 7: 121,649,257 S988G probably damaging Het
Wdr63 T C 3: 146,081,285 T332A probably damaging Het
Zbtb26 T A 2: 37,437,001 probably null Het
Zfp536 T C 7: 37,569,610 N127S probably damaging Het
Zfp750 T A 11: 121,513,017 D344V possibly damaging Het
Zmym5 T A 14: 56,794,426 K408N possibly damaging Het
Other mutations in Olfr155
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02729:Olfr155 APN 4 43854439 missense probably damaging 1.00
R0240:Olfr155 UTSW 4 43854512 missense probably damaging 1.00
R0240:Olfr155 UTSW 4 43854512 missense probably damaging 1.00
R0285:Olfr155 UTSW 4 43854398 missense possibly damaging 0.46
R0427:Olfr155 UTSW 4 43854417 missense probably damaging 1.00
R4468:Olfr155 UTSW 4 43854737 missense probably benign 0.08
R4548:Olfr155 UTSW 4 43854834 missense probably damaging 1.00
R4583:Olfr155 UTSW 4 43855262 missense probably benign
R4793:Olfr155 UTSW 4 43854323 missense probably benign 0.37
R4884:Olfr155 UTSW 4 43854890 missense probably damaging 1.00
R5016:Olfr155 UTSW 4 43854596 missense probably benign 0.02
R5220:Olfr155 UTSW 4 43854624 missense possibly damaging 0.89
R5613:Olfr155 UTSW 4 43854528 missense probably damaging 0.99
R5805:Olfr155 UTSW 4 43855152 missense probably benign 0.15
R5955:Olfr155 UTSW 4 43854898 missense probably damaging 1.00
R6250:Olfr155 UTSW 4 43854363 missense possibly damaging 0.58
R6768:Olfr155 UTSW 4 43854351 missense probably benign 0.01
R6801:Olfr155 UTSW 4 43855206 nonsense probably null
R6835:Olfr155 UTSW 4 43854912 missense probably benign 0.00
R7510:Olfr155 UTSW 4 43854482 missense probably benign 0.20
R8014:Olfr155 UTSW 4 43854958 missense probably benign 0.00
R8312:Olfr155 UTSW 4 43854461 missense probably benign 0.04
W0251:Olfr155 UTSW 4 43855058 missense probably benign 0.42
Predicted Primers PCR Primer
(F):5'- CTGGGCAGGTGGTATCACTAATTC -3'
(R):5'- AGGGAGATGAGCTTGTCTGC -3'

Sequencing Primer
(F):5'- GCAGGTGGTATCACTAATTCTGTAG -3'
(R):5'- GCAAGGTCCTGCTTGTCTGC -3'
Posted On2020-01-23