Incidental Mutation 'R8013:Nrg1'
ID617000
Institutional Source Beutler Lab
Gene Symbol Nrg1
Ensembl Gene ENSMUSG00000062991
Gene Nameneuregulin 1
SynonymsD230005F13Rik, Hgl, GGF, HRGalpha, ARIA, 6030402G23Rik, HRG, GGFII, HGL, NDF, SMDF, heregulin
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8013 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location31814551-32884029 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 31949923 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 149 (S149T)
Ref Sequence ENSEMBL: ENSMUSP00000146456 (fasta)
Predicted Effect probably benign
Transcript: ENSMUST00000207417
AA Change: S149T

PolyPhen 2 Score 0.355 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect probably benign
Transcript: ENSMUST00000207470
AA Change: S149T

PolyPhen 2 Score 0.412 (Sensitivity: 0.89; Specificity: 0.90)
Predicted Effect possibly damaging
Transcript: ENSMUST00000208205
AA Change: S149T

PolyPhen 2 Score 0.718 (Sensitivity: 0.86; Specificity: 0.92)
Predicted Effect possibly damaging
Transcript: ENSMUST00000208488
AA Change: S149T

PolyPhen 2 Score 0.620 (Sensitivity: 0.87; Specificity: 0.91)
Predicted Effect probably damaging
Transcript: ENSMUST00000208598
AA Change: S149T

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000208617
AA Change: S149T

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000208819
AA Change: S149T

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
Predicted Effect possibly damaging
Transcript: ENSMUST00000209022
AA Change: S156T

PolyPhen 2 Score 0.805 (Sensitivity: 0.84; Specificity: 0.93)
Predicted Effect probably benign
Transcript: ENSMUST00000209107
AA Change: S156T

PolyPhen 2 Score 0.087 (Sensitivity: 0.93; Specificity: 0.85)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygotes for targeted null mutations exhibit heart defects, impaired development of Schwann cell precursors, cranial ganglia, and radial glia cells, and die at embryonic day 10.5-11.5. Heterozygotes are hyperactive with reduced NMDA receptors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik T G 6: 149,328,870 V1138G probably damaging Het
6030458C11Rik C A 15: 12,824,529 D7Y probably benign Het
9530053A07Rik G A 7: 28,137,541 R295H probably benign Het
Ahnak A G 19: 9,009,335 D2661G unknown Het
Akap13 G A 7: 75,730,465 R462H probably damaging Het
Apob T A 12: 8,010,798 N3093K possibly damaging Het
Baz2a C T 10: 128,125,288 R1627C probably benign Het
Baz2a T G 10: 128,125,292 V1628G possibly damaging Het
Bbs7 A T 3: 36,594,387 I404K probably damaging Het
BC030867 A G 11: 102,257,899 N379D probably benign Het
Cacna1g T C 11: 94,456,970 Y764C probably damaging Het
Casr G A 16: 36,509,644 L443F probably benign Het
Cfap43 T A 19: 47,773,109 I849F probably damaging Het
Cntn3 A T 6: 102,199,317 H812Q probably benign Het
Cog1 A G 11: 113,656,164 D528G probably damaging Het
Depdc5 C T 5: 32,973,842 T1229M probably benign Het
Dis3 T A 14: 99,077,399 R954W possibly damaging Het
Disp2 T A 2: 118,789,682 Y298* probably null Het
Dock2 A C 11: 34,705,850 I393S probably damaging Het
Dtd1 A G 2: 144,617,332 D92G probably damaging Het
Eef2 T A 10: 81,178,196 V121D probably damaging Het
Eml1 T A 12: 108,521,679 I550N probably benign Het
Entpd7 A G 19: 43,728,055 D496G probably benign Het
Ets2 T A 16: 95,716,100 L292Q probably damaging Het
Ext1 T C 15: 53,075,887 I589V possibly damaging Het
Fam20a T A 11: 109,685,506 E142D possibly damaging Het
Farp1 T A 14: 121,242,401 I368N probably damaging Het
Fars2 C T 13: 36,205,085 Q186* probably null Het
Fbn2 T C 18: 58,104,081 T617A possibly damaging Het
Fbxo38 T C 18: 62,530,811 E203G possibly damaging Het
Fhdc1 A T 3: 84,474,639 M1K probably null Het
Gatad1 T C 5: 3,643,540 R210G probably benign Het
Gm28363 A G 1: 117,726,804 R58G probably benign Het
Gm8356 A T 14: 6,536,303 N58K probably damaging Het
Grsf1 A G 5: 88,675,756 probably null Het
Hephl1 T A 9: 15,054,609 D1016V possibly damaging Het
Kcnma1 T A 14: 23,373,143 I831F probably benign Het
Krt78 T C 15: 101,948,542 R377G probably damaging Het
Lama2 T C 10: 27,344,498 H457R probably benign Het
Lmnb1 T A 18: 56,708,359 Y83N probably damaging Het
Loxl4 A G 19: 42,607,676 C113R probably damaging Het
Lrba A T 3: 86,417,971 D1912V probably damaging Het
Macf1 T A 4: 123,526,826 T212S probably benign Het
Map3k4 A T 17: 12,271,031 C504* probably null Het
Map4k4 T C 1: 39,962,212 I53T unknown Het
Myo5b C T 18: 74,760,899 Q1700* probably null Het
Npas2 T C 1: 39,338,065 F503L probably benign Het
Olfr1243 A G 2: 89,527,936 V158A probably benign Het
Olfr155 T A 4: 43,854,958 F216L probably benign Het
Olfr697 C T 7: 106,741,617 V106I probably benign Het
Olfr824 T A 10: 130,126,778 K93M probably damaging Het
Pdia6 T C 12: 17,273,965 L66S probably damaging Het
Prss35 T C 9: 86,755,425 S83P probably damaging Het
Psme4 G A 11: 30,804,320 M192I probably benign Het
Ptprs A C 17: 56,435,994 S383A probably damaging Het
Sar1b C T 11: 51,779,794 P55L possibly damaging Het
Sgsh A G 11: 119,352,695 V67A probably damaging Het
Slc16a4 A G 3: 107,311,478 Y465C probably damaging Het
Soga1 A G 2: 157,030,786 probably null Het
Stard9 T C 2: 120,688,101 I502T probably damaging Het
Sugp2 T A 8: 70,251,642 Y610N probably damaging Het
Tbc1d24 G A 17: 24,182,821 P385S possibly damaging Het
Tm4sf1 T C 3: 57,292,898 I99V probably benign Het
Tpr G T 1: 150,398,608 V163L probably benign Het
Usp31 T C 7: 121,649,257 S988G probably damaging Het
Wdr63 T C 3: 146,081,285 T332A probably damaging Het
Zbtb26 T A 2: 37,437,001 probably null Het
Zfp536 T C 7: 37,569,610 N127S probably damaging Het
Zfp750 T A 11: 121,513,017 D344V possibly damaging Het
Zmym5 T A 14: 56,794,426 K408N possibly damaging Het
Other mutations in Nrg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00330:Nrg1 APN 8 31818089 missense probably damaging 0.99
IGL00500:Nrg1 APN 8 31822314 splice site probably null
IGL01150:Nrg1 APN 8 31917875 missense probably damaging 1.00
IGL01998:Nrg1 APN 8 31918134 missense probably damaging 0.99
IGL02010:Nrg1 APN 8 31918143 missense probably benign 0.00
IGL02501:Nrg1 APN 8 31818263 splice site probably null
IGL02741:Nrg1 APN 8 31822288 missense probably damaging 1.00
IGL02754:Nrg1 APN 8 31826363 splice site probably benign
IGL03056:Nrg1 APN 8 31821423 missense possibly damaging 0.93
IGL03121:Nrg1 APN 8 31824580 splice site probably benign
R6805_Nrg1_535 UTSW 8 31821264 missense probably damaging 1.00
R0533:Nrg1 UTSW 8 31831245 splice site probably null
R1170:Nrg1 UTSW 8 31837667 splice site probably benign
R1405:Nrg1 UTSW 8 31917827 missense probably benign 0.16
R1405:Nrg1 UTSW 8 31917827 missense probably benign 0.16
R1486:Nrg1 UTSW 8 31818344 missense probably damaging 1.00
R1642:Nrg1 UTSW 8 31824508 missense probably benign 0.45
R1653:Nrg1 UTSW 8 31818653 missense probably damaging 1.00
R1762:Nrg1 UTSW 8 31822323 missense probably damaging 0.99
R1951:Nrg1 UTSW 8 31918193 missense probably damaging 1.00
R2060:Nrg1 UTSW 8 31918015 missense probably damaging 1.00
R2912:Nrg1 UTSW 8 31818567 missense probably damaging 1.00
R3786:Nrg1 UTSW 8 31821383 missense probably damaging 1.00
R4513:Nrg1 UTSW 8 32477077 intron probably benign
R4569:Nrg1 UTSW 8 31917774 missense probably benign 0.00
R4760:Nrg1 UTSW 8 31918200 nonsense probably null
R4769:Nrg1 UTSW 8 31917972 missense probably damaging 1.00
R4834:Nrg1 UTSW 8 31917719 missense probably benign
R5058:Nrg1 UTSW 8 31824559 missense probably damaging 1.00
R5230:Nrg1 UTSW 8 31818479 missense probably damaging 0.99
R5443:Nrg1 UTSW 8 31849320 missense probably damaging 1.00
R5479:Nrg1 UTSW 8 31818377 missense probably damaging 1.00
R5940:Nrg1 UTSW 8 31849344 missense probably damaging 0.99
R6010:Nrg1 UTSW 8 31818572 missense probably damaging 1.00
R6170:Nrg1 UTSW 8 31818480 missense probably damaging 1.00
R6379:Nrg1 UTSW 8 32883721 start gained probably benign
R6460:Nrg1 UTSW 8 31818533 missense probably damaging 1.00
R6750:Nrg1 UTSW 8 31818096 missense probably damaging 1.00
R6767:Nrg1 UTSW 8 31917895 missense probably damaging 1.00
R6802:Nrg1 UTSW 8 31821264 missense probably damaging 1.00
R6804:Nrg1 UTSW 8 31821264 missense probably damaging 1.00
R6805:Nrg1 UTSW 8 31821264 missense probably damaging 1.00
R6848:Nrg1 UTSW 8 31818056 missense probably damaging 1.00
R6930:Nrg1 UTSW 8 31818506 missense probably damaging 1.00
R6963:Nrg1 UTSW 8 31917662 missense probably benign 0.04
R7070:Nrg1 UTSW 8 31849437 missense probably damaging 0.99
R7176:Nrg1 UTSW 8 31968036 nonsense probably null
R7490:Nrg1 UTSW 8 31818654 missense probably damaging 1.00
R7526:Nrg1 UTSW 8 31818323 missense probably benign 0.00
R7664:Nrg1 UTSW 8 32009141 splice site probably null
R7881:Nrg1 UTSW 8 31838324 nonsense probably null
R8342:Nrg1 UTSW 8 31822306 missense probably benign 0.04
R8759:Nrg1 UTSW 8 31818075 missense probably damaging 1.00
R8783:Nrg1 UTSW 8 31958601 missense probably benign 0.09
Z1088:Nrg1 UTSW 8 31918005 missense possibly damaging 0.68
Predicted Primers PCR Primer
(F):5'- TGTCCAAGCAACCAGGAGAC -3'
(R):5'- ACGTCTTCAAGGCACTGCTC -3'

Sequencing Primer
(F):5'- TGTATCTTGAGCCACCAATCAGG -3'
(R):5'- AAGGCACTGCTCGTCCTTG -3'
Posted On2020-01-23