Incidental Mutation 'R8013:Hephl1'
ID617002
Institutional Source Beutler Lab
Gene Symbol Hephl1
Ensembl Gene ENSMUSG00000031936
Gene Namehephaestin-like 1
SynonymsLOC244698, zyklopen, Zp
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock #R8013 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location15051841-15112108 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 15054609 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 1016 (D1016V)
Ref Sequence ENSEMBL: ENSMUSP00000124518 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000159985]
Predicted Effect possibly damaging
Transcript: ENSMUST00000159985
AA Change: D1016V

PolyPhen 2 Score 0.777 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000124518
Gene: ENSMUSG00000031936
AA Change: D1016V

DomainStartEndE-ValueType
low complexity region 7 22 N/A INTRINSIC
Pfam:Cu-oxidase_3 97 209 2.8e-12 PFAM
Pfam:Cu-oxidase_2 289 365 2.4e-9 PFAM
Pfam:Cu-oxidase_3 452 564 1.2e-9 PFAM
Blast:FA58C 604 703 9e-9 BLAST
Pfam:Cu-oxidase_3 805 908 1.6e-7 PFAM
Pfam:Cu-oxidase_2 946 1067 9e-14 PFAM
transmembrane domain 1115 1137 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik T G 6: 149,328,870 V1138G probably damaging Het
6030458C11Rik C A 15: 12,824,529 D7Y probably benign Het
9530053A07Rik G A 7: 28,137,541 R295H probably benign Het
Ahnak A G 19: 9,009,335 D2661G unknown Het
Akap13 G A 7: 75,730,465 R462H probably damaging Het
Apob T A 12: 8,010,798 N3093K possibly damaging Het
Baz2a C T 10: 128,125,288 R1627C probably benign Het
Baz2a T G 10: 128,125,292 V1628G possibly damaging Het
Bbs7 A T 3: 36,594,387 I404K probably damaging Het
BC030867 A G 11: 102,257,899 N379D probably benign Het
Cacna1g T C 11: 94,456,970 Y764C probably damaging Het
Casr G A 16: 36,509,644 L443F probably benign Het
Cfap43 T A 19: 47,773,109 I849F probably damaging Het
Cntn3 A T 6: 102,199,317 H812Q probably benign Het
Cog1 A G 11: 113,656,164 D528G probably damaging Het
Depdc5 C T 5: 32,973,842 T1229M probably benign Het
Dis3 T A 14: 99,077,399 R954W possibly damaging Het
Disp2 T A 2: 118,789,682 Y298* probably null Het
Dock2 A C 11: 34,705,850 I393S probably damaging Het
Dtd1 A G 2: 144,617,332 D92G probably damaging Het
Eef2 T A 10: 81,178,196 V121D probably damaging Het
Eml1 T A 12: 108,521,679 I550N probably benign Het
Entpd7 A G 19: 43,728,055 D496G probably benign Het
Ets2 T A 16: 95,716,100 L292Q probably damaging Het
Ext1 T C 15: 53,075,887 I589V possibly damaging Het
Fam20a T A 11: 109,685,506 E142D possibly damaging Het
Farp1 T A 14: 121,242,401 I368N probably damaging Het
Fars2 C T 13: 36,205,085 Q186* probably null Het
Fbn2 T C 18: 58,104,081 T617A possibly damaging Het
Fbxo38 T C 18: 62,530,811 E203G possibly damaging Het
Fhdc1 A T 3: 84,474,639 M1K probably null Het
Gatad1 T C 5: 3,643,540 R210G probably benign Het
Gm28363 A G 1: 117,726,804 R58G probably benign Het
Gm8356 A T 14: 6,536,303 N58K probably damaging Het
Grsf1 A G 5: 88,675,756 probably null Het
Kcnma1 T A 14: 23,373,143 I831F probably benign Het
Krt78 T C 15: 101,948,542 R377G probably damaging Het
Lama2 T C 10: 27,344,498 H457R probably benign Het
Lmnb1 T A 18: 56,708,359 Y83N probably damaging Het
Loxl4 A G 19: 42,607,676 C113R probably damaging Het
Lrba A T 3: 86,417,971 D1912V probably damaging Het
Macf1 T A 4: 123,526,826 T212S probably benign Het
Map3k4 A T 17: 12,271,031 C504* probably null Het
Map4k4 T C 1: 39,962,212 I53T unknown Het
Myo5b C T 18: 74,760,899 Q1700* probably null Het
Npas2 T C 1: 39,338,065 F503L probably benign Het
Nrg1 A T 8: 31,949,923 S149T probably benign Het
Olfr1243 A G 2: 89,527,936 V158A probably benign Het
Olfr155 T A 4: 43,854,958 F216L probably benign Het
Olfr697 C T 7: 106,741,617 V106I probably benign Het
Olfr824 T A 10: 130,126,778 K93M probably damaging Het
Pdia6 T C 12: 17,273,965 L66S probably damaging Het
Prss35 T C 9: 86,755,425 S83P probably damaging Het
Psme4 G A 11: 30,804,320 M192I probably benign Het
Ptprs A C 17: 56,435,994 S383A probably damaging Het
Sar1b C T 11: 51,779,794 P55L possibly damaging Het
Sgsh A G 11: 119,352,695 V67A probably damaging Het
Slc16a4 A G 3: 107,311,478 Y465C probably damaging Het
Soga1 A G 2: 157,030,786 probably null Het
Stard9 T C 2: 120,688,101 I502T probably damaging Het
Sugp2 T A 8: 70,251,642 Y610N probably damaging Het
Tbc1d24 G A 17: 24,182,821 P385S possibly damaging Het
Tm4sf1 T C 3: 57,292,898 I99V probably benign Het
Tpr G T 1: 150,398,608 V163L probably benign Het
Usp31 T C 7: 121,649,257 S988G probably damaging Het
Wdr63 T C 3: 146,081,285 T332A probably damaging Het
Zbtb26 T A 2: 37,437,001 probably null Het
Zfp536 T C 7: 37,569,610 N127S probably damaging Het
Zfp750 T A 11: 121,513,017 D344V possibly damaging Het
Zmym5 T A 14: 56,794,426 K408N possibly damaging Het
Other mutations in Hephl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00979:Hephl1 APN 9 15067045 missense probably benign 0.06
IGL01105:Hephl1 APN 9 15089024 missense possibly damaging 0.95
IGL01731:Hephl1 APN 9 15069770 missense probably damaging 1.00
IGL02010:Hephl1 APN 9 15090556 nonsense probably null
IGL02112:Hephl1 APN 9 15081815 splice site probably benign
IGL02227:Hephl1 APN 9 15069793 missense probably damaging 1.00
IGL02490:Hephl1 APN 9 15053685 missense probably benign 0.06
IGL02960:Hephl1 APN 9 15084319 missense probably damaging 1.00
IGL03265:Hephl1 APN 9 15060959 missense probably benign 0.14
R0006:Hephl1 UTSW 9 15076764 missense probably benign 0.16
R0006:Hephl1 UTSW 9 15076764 missense probably benign 0.16
R0007:Hephl1 UTSW 9 15086175 missense possibly damaging 0.58
R0092:Hephl1 UTSW 9 15090603 frame shift probably null
R0421:Hephl1 UTSW 9 15059160 missense probably benign 0.05
R0448:Hephl1 UTSW 9 15076926 missense probably damaging 1.00
R0563:Hephl1 UTSW 9 15081945 missense probably damaging 1.00
R0602:Hephl1 UTSW 9 15089051 missense probably damaging 0.99
R0631:Hephl1 UTSW 9 15084524 missense probably benign 0.04
R0747:Hephl1 UTSW 9 15054001 splice site probably benign
R1123:Hephl1 UTSW 9 15080140 missense probably benign 0.00
R1386:Hephl1 UTSW 9 15076754 missense probably benign
R1711:Hephl1 UTSW 9 15059246 missense probably damaging 1.00
R1743:Hephl1 UTSW 9 15090068 missense probably damaging 0.99
R1833:Hephl1 UTSW 9 15076928 missense probably damaging 0.99
R1908:Hephl1 UTSW 9 15074124 nonsense probably null
R1918:Hephl1 UTSW 9 15076818 missense probably benign 0.16
R1938:Hephl1 UTSW 9 15053987 missense possibly damaging 0.88
R1986:Hephl1 UTSW 9 15054552 missense probably damaging 1.00
R3122:Hephl1 UTSW 9 15088969 missense possibly damaging 0.90
R3832:Hephl1 UTSW 9 15069748 missense probably damaging 1.00
R3833:Hephl1 UTSW 9 15069748 missense probably damaging 1.00
R4280:Hephl1 UTSW 9 15112034 missense probably benign 0.05
R4434:Hephl1 UTSW 9 15076796 missense probably damaging 0.99
R4790:Hephl1 UTSW 9 15059171 missense probably damaging 1.00
R4793:Hephl1 UTSW 9 15097990 missense probably benign 0.34
R4960:Hephl1 UTSW 9 15086290 missense probably damaging 1.00
R5125:Hephl1 UTSW 9 15086172 missense probably damaging 0.98
R5152:Hephl1 UTSW 9 15080185 missense probably damaging 1.00
R5178:Hephl1 UTSW 9 15086172 missense probably damaging 0.98
R5288:Hephl1 UTSW 9 15076854 missense possibly damaging 0.83
R5372:Hephl1 UTSW 9 15097899 nonsense probably null
R5377:Hephl1 UTSW 9 15069788 missense probably damaging 1.00
R5788:Hephl1 UTSW 9 15084283 missense possibly damaging 0.93
R5795:Hephl1 UTSW 9 15069760 missense probably damaging 0.99
R6210:Hephl1 UTSW 9 15090564 missense possibly damaging 0.57
R6303:Hephl1 UTSW 9 15090152 missense possibly damaging 0.69
R6394:Hephl1 UTSW 9 15074101 missense probably benign 0.00
R6653:Hephl1 UTSW 9 15081964 missense probably damaging 0.99
R6764:Hephl1 UTSW 9 15088921 missense possibly damaging 0.88
R7114:Hephl1 UTSW 9 15069815 missense probably damaging 0.96
R7143:Hephl1 UTSW 9 15060810 missense possibly damaging 0.80
R7404:Hephl1 UTSW 9 15069751 missense possibly damaging 0.84
R7446:Hephl1 UTSW 9 15098051 missense probably damaging 1.00
R7447:Hephl1 UTSW 9 15097882 critical splice donor site probably null
R7715:Hephl1 UTSW 9 15060785 missense probably benign 0.36
X0026:Hephl1 UTSW 9 15084228 critical splice donor site probably null
X0066:Hephl1 UTSW 9 15053668 missense probably benign 0.00
Z1088:Hephl1 UTSW 9 15053721 missense probably damaging 1.00
Z1177:Hephl1 UTSW 9 15090054 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCATGAGCTAGCATCACTGAC -3'
(R):5'- CCAAAGGAATGCTTCTTCGATC -3'

Sequencing Primer
(F):5'- GACAAACAGTACCTATGTTCCTGAGG -3'
(R):5'- AAGGAATGCTTCTTCGATCATATAC -3'
Posted On2020-01-23