Mutagenetix > Incidental Mutation

Incidental Mutation 'R8013:Hephl1'

617002

Institutional Source

Beutler Lab

Gene Symbol

Hephl1

Ensembl Gene

ENSMUSG00000031936

Gene Name

hephaestin-like 1

Synonyms

LOC244698, zyklopen, Zp

MMRRC Submission

067453-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.081) question?

Stock #

R8013 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

15051841-15112108 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 15054609 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Valine at position 1016 (D1016V)

Ref Sequence

ENSEMBL: ENSMUSP00000124518 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000159985]

AlphaFold

Q3V1H3

Predicted Effect

possibly damaging
Transcript: ENSMUST00000159985
AA Change: D1016V

PolyPhen 2 Score 0.777 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000124518
Gene: ENSMUSG00000031936
AA Change: D1016V

Domain	Start	End	E-Value	Type
low complexity region	7	22	N/A	INTRINSIC
Pfam:Cu-oxidase_3	97	209	2.8e-12	PFAM
Pfam:Cu-oxidase_2	289	365	2.4e-9	PFAM
Pfam:Cu-oxidase_3	452	564	1.2e-9	PFAM
Blast:FA58C	604	703	9e-9	BLAST
Pfam:Cu-oxidase_3	805	908	1.6e-7	PFAM
Pfam:Cu-oxidase_2	946	1067	9e-14	PFAM
transmembrane domain	1115	1137	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.4%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2810474O19Rik	T	G	6: 149,328,870	V1138G	probably damaging	Het
6030458C11Rik	C	A	15: 12,824,529	D7Y	probably benign	Het
9530053A07Rik	G	A	7: 28,137,541	R295H	probably benign	Het
Ahnak	A	G	19: 9,009,335	D2661G	unknown	Het
Akap13	G	A	7: 75,730,465	R462H	probably damaging	Het
Apob	T	A	12: 8,010,798	N3093K	possibly damaging	Het
Baz2a	C	T	10: 128,125,288	R1627C	probably benign	Het
Baz2a	T	G	10: 128,125,292	V1628G	possibly damaging	Het
Bbs7	A	T	3: 36,594,387	I404K	probably damaging	Het
BC030867	A	G	11: 102,257,899	N379D	probably benign	Het
Cacna1g	T	C	11: 94,456,970	Y764C	probably damaging	Het
Casr	G	A	16: 36,509,644	L443F	probably benign	Het
Cfap43	T	A	19: 47,773,109	I849F	probably damaging	Het
Cntn3	A	T	6: 102,199,317	H812Q	probably benign	Het
Cog1	A	G	11: 113,656,164	D528G	probably damaging	Het
Depdc5	C	T	5: 32,973,842	T1229M	probably benign	Het
Dis3	T	A	14: 99,077,399	R954W	possibly damaging	Het
Disp2	T	A	2: 118,789,682	Y298*	probably null	Het
Dock2	A	C	11: 34,705,850	I393S	probably damaging	Het
Dtd1	A	G	2: 144,617,332	D92G	probably damaging	Het
Eef2	T	A	10: 81,178,196	V121D	probably damaging	Het
Eml1	T	A	12: 108,521,679	I550N	probably benign	Het
Entpd7	A	G	19: 43,728,055	D496G	probably benign	Het
Ets2	T	A	16: 95,716,100	L292Q	probably damaging	Het
Ext1	T	C	15: 53,075,887	I589V	possibly damaging	Het
Fam20a	T	A	11: 109,685,506	E142D	possibly damaging	Het
Farp1	T	A	14: 121,242,401	I368N	probably damaging	Het
Fars2	C	T	13: 36,205,085	Q186*	probably null	Het
Fbn2	T	C	18: 58,104,081	T617A	possibly damaging	Het
Fbxo38	T	C	18: 62,530,811	E203G	possibly damaging	Het
Fhdc1	A	T	3: 84,474,639	M1K	probably null	Het
Gatad1	T	C	5: 3,643,540	R210G	probably benign	Het
Gm28363	A	G	1: 117,726,804	R58G	probably benign	Het
Gm8356	A	T	14: 6,536,303	N58K	probably damaging	Het
Grsf1	A	G	5: 88,675,756		probably null	Het
Kcnma1	T	A	14: 23,373,143	I831F	probably benign	Het
Krt78	T	C	15: 101,948,542	R377G	probably damaging	Het
Lama2	T	C	10: 27,344,498	H457R	probably benign	Het
Lmnb1	T	A	18: 56,708,359	Y83N	probably damaging	Het
Loxl4	A	G	19: 42,607,676	C113R	probably damaging	Het
Lrba	A	T	3: 86,417,971	D1912V	probably damaging	Het
Macf1	T	A	4: 123,526,826	T212S	probably benign	Het
Map3k4	A	T	17: 12,271,031	C504*	probably null	Het
Map4k4	T	C	1: 39,962,212	I53T	unknown	Het
Myo5b	C	T	18: 74,760,899	Q1700*	probably null	Het
Npas2	T	C	1: 39,338,065	F503L	probably benign	Het
Nrg1	A	T	8: 31,949,923	S149T	probably benign	Het
Olfr1243	A	G	2: 89,527,936	V158A	probably benign	Het
Olfr155	T	A	4: 43,854,958	F216L	probably benign	Het
Olfr697	C	T	7: 106,741,617	V106I	probably benign	Het
Olfr824	T	A	10: 130,126,778	K93M	probably damaging	Het
Pdia6	T	C	12: 17,273,965	L66S	probably damaging	Het
Prss35	T	C	9: 86,755,425	S83P	probably damaging	Het
Psme4	G	A	11: 30,804,320	M192I	probably benign	Het
Ptprs	A	C	17: 56,435,994	S383A	probably damaging	Het
Sar1b	C	T	11: 51,779,794	P55L	possibly damaging	Het
Sgsh	A	G	11: 119,352,695	V67A	probably damaging	Het
Slc16a4	A	G	3: 107,311,478	Y465C	probably damaging	Het
Soga1	A	G	2: 157,030,786		probably null	Het
Stard9	T	C	2: 120,688,101	I502T	probably damaging	Het
Sugp2	T	A	8: 70,251,642	Y610N	probably damaging	Het
Tbc1d24	G	A	17: 24,182,821	P385S	possibly damaging	Het
Tm4sf1	T	C	3: 57,292,898	I99V	probably benign	Het
Tpr	G	T	1: 150,398,608	V163L	probably benign	Het
Usp31	T	C	7: 121,649,257	S988G	probably damaging	Het
Wdr63	T	C	3: 146,081,285	T332A	probably damaging	Het
Zbtb26	T	A	2: 37,437,001		probably null	Het
Zfp536	T	C	7: 37,569,610	N127S	probably damaging	Het
Zfp750	T	A	11: 121,513,017	D344V	possibly damaging	Het
Zmym5	T	A	14: 56,794,426	K408N	possibly damaging	Het

Other mutations in Hephl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00979:Hephl1	APN	9	15067045	missense	probably benign	0.06
IGL01105:Hephl1	APN	9	15089024	missense	possibly damaging	0.95
IGL01731:Hephl1	APN	9	15069770	missense	probably damaging	1.00
IGL02010:Hephl1	APN	9	15090556	nonsense	probably null
IGL02112:Hephl1	APN	9	15081815	splice site	probably benign
IGL02227:Hephl1	APN	9	15069793	missense	probably damaging	1.00
IGL02490:Hephl1	APN	9	15053685	missense	probably benign	0.06
IGL02960:Hephl1	APN	9	15084319	missense	probably damaging	1.00
IGL03265:Hephl1	APN	9	15060959	missense	probably benign	0.14
R0006:Hephl1	UTSW	9	15076764	missense	probably benign	0.16
R0006:Hephl1	UTSW	9	15076764	missense	probably benign	0.16
R0007:Hephl1	UTSW	9	15086175	missense	possibly damaging	0.58
R0092:Hephl1	UTSW	9	15090603	frame shift	probably null
R0421:Hephl1	UTSW	9	15059160	missense	probably benign	0.05
R0448:Hephl1	UTSW	9	15076926	missense	probably damaging	1.00
R0563:Hephl1	UTSW	9	15081945	missense	probably damaging	1.00
R0602:Hephl1	UTSW	9	15089051	missense	probably damaging	0.99
R0631:Hephl1	UTSW	9	15084524	missense	probably benign	0.04
R0747:Hephl1	UTSW	9	15054001	splice site	probably benign
R1123:Hephl1	UTSW	9	15080140	missense	probably benign	0.00
R1386:Hephl1	UTSW	9	15076754	missense	probably benign
R1711:Hephl1	UTSW	9	15059246	missense	probably damaging	1.00
R1743:Hephl1	UTSW	9	15090068	missense	probably damaging	0.99
R1833:Hephl1	UTSW	9	15076928	missense	probably damaging	0.99
R1908:Hephl1	UTSW	9	15074124	nonsense	probably null
R1918:Hephl1	UTSW	9	15076818	missense	probably benign	0.16
R1938:Hephl1	UTSW	9	15053987	missense	possibly damaging	0.88
R1986:Hephl1	UTSW	9	15054552	missense	probably damaging	1.00
R3122:Hephl1	UTSW	9	15088969	missense	possibly damaging	0.90
R3832:Hephl1	UTSW	9	15069748	missense	probably damaging	1.00
R3833:Hephl1	UTSW	9	15069748	missense	probably damaging	1.00
R4280:Hephl1	UTSW	9	15112034	missense	probably benign	0.05
R4434:Hephl1	UTSW	9	15076796	missense	probably damaging	0.99
R4790:Hephl1	UTSW	9	15059171	missense	probably damaging	1.00
R4793:Hephl1	UTSW	9	15097990	missense	probably benign	0.34
R4960:Hephl1	UTSW	9	15086290	missense	probably damaging	1.00
R5125:Hephl1	UTSW	9	15086172	missense	probably damaging	0.98
R5152:Hephl1	UTSW	9	15080185	missense	probably damaging	1.00
R5178:Hephl1	UTSW	9	15086172	missense	probably damaging	0.98
R5288:Hephl1	UTSW	9	15076854	missense	possibly damaging	0.83
R5372:Hephl1	UTSW	9	15097899	nonsense	probably null
R5377:Hephl1	UTSW	9	15069788	missense	probably damaging	1.00
R5788:Hephl1	UTSW	9	15084283	missense	possibly damaging	0.93
R5795:Hephl1	UTSW	9	15069760	missense	probably damaging	0.99
R6210:Hephl1	UTSW	9	15090564	missense	possibly damaging	0.57
R6303:Hephl1	UTSW	9	15090152	missense	possibly damaging	0.69
R6394:Hephl1	UTSW	9	15074101	missense	probably benign	0.00
R6653:Hephl1	UTSW	9	15081964	missense	probably damaging	0.99
R6764:Hephl1	UTSW	9	15088921	missense	possibly damaging	0.88
R7114:Hephl1	UTSW	9	15069815	missense	probably damaging	0.96
R7143:Hephl1	UTSW	9	15060810	missense	possibly damaging	0.80
R7404:Hephl1	UTSW	9	15069751	missense	possibly damaging	0.84
R7446:Hephl1	UTSW	9	15098051	missense	probably damaging	1.00
R7447:Hephl1	UTSW	9	15097882	critical splice donor site	probably null
R7715:Hephl1	UTSW	9	15060785	missense	probably benign	0.36
R8156:Hephl1	UTSW	9	15060914	missense	possibly damaging	0.77
R8755:Hephl1	UTSW	9	15074267	missense	probably benign
R8755:Hephl1	UTSW	9	15111984	missense	probably damaging	1.00
R8777:Hephl1	UTSW	9	15060794	missense	probably benign	0.24
R8777-TAIL:Hephl1	UTSW	9	15060794	missense	probably benign	0.24
R9090:Hephl1	UTSW	9	15076940	missense	probably damaging	1.00
R9155:Hephl1	UTSW	9	15089079	missense	probably damaging	1.00
R9271:Hephl1	UTSW	9	15076940	missense	probably damaging	1.00
R9287:Hephl1	UTSW	9	15084479	missense	probably benign	0.01
R9487:Hephl1	UTSW	9	15084534	missense	possibly damaging	0.84
X0026:Hephl1	UTSW	9	15084228	critical splice donor site	probably null
X0066:Hephl1	UTSW	9	15053668	missense	probably benign	0.00
Z1088:Hephl1	UTSW	9	15053721	missense	probably damaging	1.00
Z1177:Hephl1	UTSW	9	15090054	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCCATGAGCTAGCATCACTGAC -3'
(R):5'- CCAAAGGAATGCTTCTTCGATC -3'

Sequencing Primer
(F):5'- GACAAACAGTACCTATGTTCCTGAGG -3'
(R):5'- AAGGAATGCTTCTTCGATCATATAC -3'

Posted On

2020-01-23