Incidental Mutation 'R8013:Psme4'
ID617009
Institutional Source Beutler Lab
Gene Symbol Psme4
Ensembl Gene ENSMUSG00000040850
Gene Nameproteasome (prosome, macropain) activator subunit 4
Synonyms
Accession Numbers

Genbank: NM_134013

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8013 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location30771726-30880361 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 30804320 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Isoleucine at position 192 (M192I)
Ref Sequence ENSEMBL: ENSMUSP00000045460 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041231]
Predicted Effect probably benign
Transcript: ENSMUST00000041231
AA Change: M192I

PolyPhen 2 Score 0.062 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000045460
Gene: ENSMUSG00000040850
AA Change: M192I

DomainStartEndE-ValueType
low complexity region 2 19 N/A INTRINSIC
low complexity region 122 133 N/A INTRINSIC
Pfam:BLM10_mid 330 828 8.8e-119 PFAM
SCOP:d1b3ua_ 1183 1716 3e-14 SMART
Pfam:DUF3437 1756 1843 5.3e-39 PFAM
Predicted Effect
SMART Domains Protein: ENSMUSP00000119133
Gene: ENSMUSG00000040850
AA Change: M200I

DomainStartEndE-ValueType
low complexity region 131 142 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele show normal repair of DNA double-strand breaks but exhibit significantly reduced male fertility due to defects in spermatogenesis observed in both meiotic spermatocytes and postmeiotic haploid spermatids. [provided by MGI curators]
Allele List at MGI

All alleles(25) : Targeted, knock-out(1) Gene trapped(24)

Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik T G 6: 149,328,870 V1138G probably damaging Het
6030458C11Rik C A 15: 12,824,529 D7Y probably benign Het
9530053A07Rik G A 7: 28,137,541 R295H probably benign Het
Ahnak A G 19: 9,009,335 D2661G unknown Het
Akap13 G A 7: 75,730,465 R462H probably damaging Het
Apob T A 12: 8,010,798 N3093K possibly damaging Het
Baz2a C T 10: 128,125,288 R1627C probably benign Het
Baz2a T G 10: 128,125,292 V1628G possibly damaging Het
Bbs7 A T 3: 36,594,387 I404K probably damaging Het
BC030867 A G 11: 102,257,899 N379D probably benign Het
Cacna1g T C 11: 94,456,970 Y764C probably damaging Het
Casr G A 16: 36,509,644 L443F probably benign Het
Cfap43 T A 19: 47,773,109 I849F probably damaging Het
Cntn3 A T 6: 102,199,317 H812Q probably benign Het
Cog1 A G 11: 113,656,164 D528G probably damaging Het
Depdc5 C T 5: 32,973,842 T1229M probably benign Het
Dis3 T A 14: 99,077,399 R954W possibly damaging Het
Disp2 T A 2: 118,789,682 Y298* probably null Het
Dock2 A C 11: 34,705,850 I393S probably damaging Het
Dtd1 A G 2: 144,617,332 D92G probably damaging Het
Eef2 T A 10: 81,178,196 V121D probably damaging Het
Eml1 T A 12: 108,521,679 I550N probably benign Het
Entpd7 A G 19: 43,728,055 D496G probably benign Het
Ets2 T A 16: 95,716,100 L292Q probably damaging Het
Ext1 T C 15: 53,075,887 I589V possibly damaging Het
Fam20a T A 11: 109,685,506 E142D possibly damaging Het
Farp1 T A 14: 121,242,401 I368N probably damaging Het
Fars2 C T 13: 36,205,085 Q186* probably null Het
Fbn2 T C 18: 58,104,081 T617A possibly damaging Het
Fbxo38 T C 18: 62,530,811 E203G possibly damaging Het
Fhdc1 A T 3: 84,474,639 M1K probably null Het
Gatad1 T C 5: 3,643,540 R210G probably benign Het
Gm28363 A G 1: 117,726,804 R58G probably benign Het
Gm8356 A T 14: 6,536,303 N58K probably damaging Het
Grsf1 A G 5: 88,675,756 probably null Het
Hephl1 T A 9: 15,054,609 D1016V possibly damaging Het
Kcnma1 T A 14: 23,373,143 I831F probably benign Het
Krt78 T C 15: 101,948,542 R377G probably damaging Het
Lama2 T C 10: 27,344,498 H457R probably benign Het
Lmnb1 T A 18: 56,708,359 Y83N probably damaging Het
Loxl4 A G 19: 42,607,676 C113R probably damaging Het
Lrba A T 3: 86,417,971 D1912V probably damaging Het
Macf1 T A 4: 123,526,826 T212S probably benign Het
Map3k4 A T 17: 12,271,031 C504* probably null Het
Map4k4 T C 1: 39,962,212 I53T unknown Het
Myo5b C T 18: 74,760,899 Q1700* probably null Het
Npas2 T C 1: 39,338,065 F503L probably benign Het
Nrg1 A T 8: 31,949,923 S149T probably benign Het
Olfr1243 A G 2: 89,527,936 V158A probably benign Het
Olfr155 T A 4: 43,854,958 F216L probably benign Het
Olfr697 C T 7: 106,741,617 V106I probably benign Het
Olfr824 T A 10: 130,126,778 K93M probably damaging Het
Pdia6 T C 12: 17,273,965 L66S probably damaging Het
Prss35 T C 9: 86,755,425 S83P probably damaging Het
Ptprs A C 17: 56,435,994 S383A probably damaging Het
Sar1b C T 11: 51,779,794 P55L possibly damaging Het
Sgsh A G 11: 119,352,695 V67A probably damaging Het
Slc16a4 A G 3: 107,311,478 Y465C probably damaging Het
Soga1 A G 2: 157,030,786 probably null Het
Stard9 T C 2: 120,688,101 I502T probably damaging Het
Sugp2 T A 8: 70,251,642 Y610N probably damaging Het
Tbc1d24 G A 17: 24,182,821 P385S possibly damaging Het
Tm4sf1 T C 3: 57,292,898 I99V probably benign Het
Tpr G T 1: 150,398,608 V163L probably benign Het
Usp31 T C 7: 121,649,257 S988G probably damaging Het
Wdr63 T C 3: 146,081,285 T332A probably damaging Het
Zbtb26 T A 2: 37,437,001 probably null Het
Zfp536 T C 7: 37,569,610 N127S probably damaging Het
Zfp750 T A 11: 121,513,017 D344V possibly damaging Het
Zmym5 T A 14: 56,794,426 K408N possibly damaging Het
Other mutations in Psme4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00228:Psme4 APN 11 30815710 critical splice donor site probably null
IGL00401:Psme4 APN 11 30821079 splice site probably benign
IGL00475:Psme4 APN 11 30845252 missense probably benign 0.14
IGL00576:Psme4 APN 11 30823145 missense possibly damaging 0.50
IGL00817:Psme4 APN 11 30820129 missense probably benign 0.01
IGL01525:Psme4 APN 11 30809936 splice site probably benign
IGL01862:Psme4 APN 11 30812038 nonsense probably null
IGL02310:Psme4 APN 11 30837484 missense probably benign 0.06
IGL02477:Psme4 APN 11 30842083 missense probably damaging 0.99
IGL02545:Psme4 APN 11 30841586 missense possibly damaging 0.81
IGL02608:Psme4 APN 11 30820944 missense probably benign 0.34
IGL02621:Psme4 APN 11 30848131 missense probably benign
IGL02822:Psme4 APN 11 30848204 unclassified probably benign
IGL02833:Psme4 APN 11 30850715 unclassified probably benign
IGL02964:Psme4 APN 11 30791095 nonsense probably null
IGL03273:Psme4 APN 11 30848130 missense probably damaging 1.00
IGL03348:Psme4 APN 11 30876796 missense probably damaging 1.00
IGL03382:Psme4 APN 11 30807788 missense possibly damaging 0.94
H2330:Psme4 UTSW 11 30851210 missense probably benign 0.17
PIT4378001:Psme4 UTSW 11 30821079 splice site probably benign
R0276:Psme4 UTSW 11 30811980 missense probably damaging 1.00
R0462:Psme4 UTSW 11 30848117 missense probably damaging 1.00
R0685:Psme4 UTSW 11 30878415 missense probably damaging 1.00
R0766:Psme4 UTSW 11 30807687 intron probably null
R0830:Psme4 UTSW 11 30807797 missense possibly damaging 0.53
R0940:Psme4 UTSW 11 30815264 missense possibly damaging 0.53
R1018:Psme4 UTSW 11 30804310 missense probably damaging 1.00
R1312:Psme4 UTSW 11 30807687 intron probably null
R1448:Psme4 UTSW 11 30852744 missense probably damaging 1.00
R1713:Psme4 UTSW 11 30806310 missense probably damaging 1.00
R1732:Psme4 UTSW 11 30848105 missense probably benign 0.03
R1813:Psme4 UTSW 11 30804353 missense probably benign 0.14
R1905:Psme4 UTSW 11 30810922 missense probably damaging 1.00
R1907:Psme4 UTSW 11 30810922 missense probably damaging 1.00
R1911:Psme4 UTSW 11 30815658 missense probably benign 0.02
R1956:Psme4 UTSW 11 30832424 missense probably damaging 0.99
R1974:Psme4 UTSW 11 30819011 missense probably benign 0.00
R1980:Psme4 UTSW 11 30832615 missense possibly damaging 0.84
R1986:Psme4 UTSW 11 30830352 missense probably benign 0.01
R2046:Psme4 UTSW 11 30817723 splice site probably benign
R2142:Psme4 UTSW 11 30820998 missense possibly damaging 0.89
R2698:Psme4 UTSW 11 30874282 critical splice donor site probably null
R2844:Psme4 UTSW 11 30845173 splice site probably benign
R3807:Psme4 UTSW 11 30856027 splice site probably null
R3876:Psme4 UTSW 11 30856068 missense probably damaging 0.99
R4420:Psme4 UTSW 11 30812028 missense possibly damaging 0.67
R4584:Psme4 UTSW 11 30834318 missense probably damaging 1.00
R4615:Psme4 UTSW 11 30834287 missense probably benign 0.02
R4714:Psme4 UTSW 11 30832573 missense probably benign 0.02
R5008:Psme4 UTSW 11 30856896 intron probably benign
R5109:Psme4 UTSW 11 30791095 nonsense probably null
R5155:Psme4 UTSW 11 30876806 missense probably damaging 1.00
R5199:Psme4 UTSW 11 30853272 missense probably benign 0.00
R5205:Psme4 UTSW 11 30832666 intron probably benign
R5452:Psme4 UTSW 11 30791168 missense probably benign
R5491:Psme4 UTSW 11 30815246 missense possibly damaging 0.63
R5685:Psme4 UTSW 11 30809837 missense probably damaging 0.99
R5764:Psme4 UTSW 11 30772364 intron probably benign
R5853:Psme4 UTSW 11 30791234 critical splice donor site probably null
R5865:Psme4 UTSW 11 30791993 missense possibly damaging 0.95
R5903:Psme4 UTSW 11 30841589 missense probably benign 0.28
R5927:Psme4 UTSW 11 30804294 missense possibly damaging 0.82
R6004:Psme4 UTSW 11 30856896 intron probably benign
R6102:Psme4 UTSW 11 30865567 missense probably damaging 1.00
R6247:Psme4 UTSW 11 30853245 missense possibly damaging 0.60
R6527:Psme4 UTSW 11 30832175 missense probably benign
R6750:Psme4 UTSW 11 30853203 missense probably damaging 1.00
R6885:Psme4 UTSW 11 30834307 nonsense probably null
R6939:Psme4 UTSW 11 30837291 missense probably damaging 0.99
R6945:Psme4 UTSW 11 30837437 missense probably benign 0.06
R7029:Psme4 UTSW 11 30772474 intron probably benign
R7049:Psme4 UTSW 11 30813904 intron probably null
R7098:Psme4 UTSW 11 30850661 missense probably damaging 0.99
R7107:Psme4 UTSW 11 30848105 missense probably benign 0.03
R7223:Psme4 UTSW 11 30874226 missense probably benign 0.33
R7319:Psme4 UTSW 11 30807790 missense probably benign 0.00
R7375:Psme4 UTSW 11 30772700 intron probably null
R7410:Psme4 UTSW 11 30815279 nonsense probably null
R7469:Psme4 UTSW 11 30802837 missense probably benign 0.20
R7651:Psme4 UTSW 11 30837334 missense probably damaging 0.98
R7679:Psme4 UTSW 11 30878425 missense probably damaging 0.99
R7681:Psme4 UTSW 11 30791975 missense possibly damaging 0.63
R7822:Psme4 UTSW 11 30874245 missense probably benign
V5088:Psme4 UTSW 11 30851210 missense probably benign 0.17
X0063:Psme4 UTSW 11 30832600 missense possibly damaging 0.66
Z1176:Psme4 UTSW 11 30843522 missense possibly damaging 0.87
Z1177:Psme4 UTSW 11 30806311 missense probably damaging 1.00
Z1177:Psme4 UTSW 11 30812138 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTGCTGTTGGGGAACAAACC -3'
(R):5'- TTAACAACTGTAACAACTTGCTCCC -3'

Sequencing Primer
(F):5'- ACCCAGGTCCTATGTATACAGGG -3'
(R):5'- AACTATCATTTCATTGGGCTTGTC -3'
Posted On2020-01-23