Incidental Mutation 'R8013:Sar1b'
ID617011
Institutional Source Beutler Lab
Gene Symbol Sar1b
Ensembl Gene ENSMUSG00000020386
Gene Namesecretion associated Ras related GTPase 1B
SynonymsSara2, 2310075M17Rik, 2900019I22Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8013 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location51763687-51791925 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 51779794 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 55 (P55L)
Ref Sequence ENSEMBL: ENSMUSP00000020653 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020653]
Predicted Effect possibly damaging
Transcript: ENSMUST00000020653
AA Change: P55L

PolyPhen 2 Score 0.803 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000020653
Gene: ENSMUSG00000020386
AA Change: P55L

DomainStartEndE-ValueType
SAR 5 197 9.22e-101 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a small GTPase that acts as a homodimer. The encoded protein is activated by the guanine nucleotide exchange factor PREB and is involved in protein transport from the endoplasmic reticulum to the Golgi. This protein is part of the COPII coat complex. Defects in this gene are a cause of chylomicron retention disease (CMRD), also known as Anderson disease (ANDD). Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Mar 2010]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik T G 6: 149,328,870 V1138G probably damaging Het
6030458C11Rik C A 15: 12,824,529 D7Y probably benign Het
9530053A07Rik G A 7: 28,137,541 R295H probably benign Het
Ahnak A G 19: 9,009,335 D2661G unknown Het
Akap13 G A 7: 75,730,465 R462H probably damaging Het
Apob T A 12: 8,010,798 N3093K possibly damaging Het
Baz2a C T 10: 128,125,288 R1627C probably benign Het
Baz2a T G 10: 128,125,292 V1628G possibly damaging Het
Bbs7 A T 3: 36,594,387 I404K probably damaging Het
BC030867 A G 11: 102,257,899 N379D probably benign Het
Cacna1g T C 11: 94,456,970 Y764C probably damaging Het
Casr G A 16: 36,509,644 L443F probably benign Het
Cfap43 T A 19: 47,773,109 I849F probably damaging Het
Cntn3 A T 6: 102,199,317 H812Q probably benign Het
Cog1 A G 11: 113,656,164 D528G probably damaging Het
Depdc5 C T 5: 32,973,842 T1229M probably benign Het
Dis3 T A 14: 99,077,399 R954W possibly damaging Het
Disp2 T A 2: 118,789,682 Y298* probably null Het
Dock2 A C 11: 34,705,850 I393S probably damaging Het
Dtd1 A G 2: 144,617,332 D92G probably damaging Het
Eef2 T A 10: 81,178,196 V121D probably damaging Het
Eml1 T A 12: 108,521,679 I550N probably benign Het
Entpd7 A G 19: 43,728,055 D496G probably benign Het
Ets2 T A 16: 95,716,100 L292Q probably damaging Het
Ext1 T C 15: 53,075,887 I589V possibly damaging Het
Fam20a T A 11: 109,685,506 E142D possibly damaging Het
Farp1 T A 14: 121,242,401 I368N probably damaging Het
Fars2 C T 13: 36,205,085 Q186* probably null Het
Fbn2 T C 18: 58,104,081 T617A possibly damaging Het
Fbxo38 T C 18: 62,530,811 E203G possibly damaging Het
Fhdc1 A T 3: 84,474,639 M1K probably null Het
Gatad1 T C 5: 3,643,540 R210G probably benign Het
Gm28363 A G 1: 117,726,804 R58G probably benign Het
Gm8356 A T 14: 6,536,303 N58K probably damaging Het
Grsf1 A G 5: 88,675,756 probably null Het
Hephl1 T A 9: 15,054,609 D1016V possibly damaging Het
Kcnma1 T A 14: 23,373,143 I831F probably benign Het
Krt78 T C 15: 101,948,542 R377G probably damaging Het
Lama2 T C 10: 27,344,498 H457R probably benign Het
Lmnb1 T A 18: 56,708,359 Y83N probably damaging Het
Loxl4 A G 19: 42,607,676 C113R probably damaging Het
Lrba A T 3: 86,417,971 D1912V probably damaging Het
Macf1 T A 4: 123,526,826 T212S probably benign Het
Map3k4 A T 17: 12,271,031 C504* probably null Het
Map4k4 T C 1: 39,962,212 I53T unknown Het
Myo5b C T 18: 74,760,899 Q1700* probably null Het
Npas2 T C 1: 39,338,065 F503L probably benign Het
Nrg1 A T 8: 31,949,923 S149T probably benign Het
Olfr1243 A G 2: 89,527,936 V158A probably benign Het
Olfr155 T A 4: 43,854,958 F216L probably benign Het
Olfr697 C T 7: 106,741,617 V106I probably benign Het
Olfr824 T A 10: 130,126,778 K93M probably damaging Het
Pdia6 T C 12: 17,273,965 L66S probably damaging Het
Prss35 T C 9: 86,755,425 S83P probably damaging Het
Psme4 G A 11: 30,804,320 M192I probably benign Het
Ptprs A C 17: 56,435,994 S383A probably damaging Het
Sgsh A G 11: 119,352,695 V67A probably damaging Het
Slc16a4 A G 3: 107,311,478 Y465C probably damaging Het
Soga1 A G 2: 157,030,786 probably null Het
Stard9 T C 2: 120,688,101 I502T probably damaging Het
Sugp2 T A 8: 70,251,642 Y610N probably damaging Het
Tbc1d24 G A 17: 24,182,821 P385S possibly damaging Het
Tm4sf1 T C 3: 57,292,898 I99V probably benign Het
Tpr G T 1: 150,398,608 V163L probably benign Het
Usp31 T C 7: 121,649,257 S988G probably damaging Het
Wdr63 T C 3: 146,081,285 T332A probably damaging Het
Zbtb26 T A 2: 37,437,001 probably null Het
Zfp536 T C 7: 37,569,610 N127S probably damaging Het
Zfp750 T A 11: 121,513,017 D344V possibly damaging Het
Zmym5 T A 14: 56,794,426 K408N possibly damaging Het
Other mutations in Sar1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01447:Sar1b APN 11 51791447 utr 3 prime probably benign
IGL02073:Sar1b APN 11 51789193 splice site probably benign
R2018:Sar1b UTSW 11 51779687 critical splice acceptor site probably null
R5901:Sar1b UTSW 11 51779749 missense possibly damaging 0.78
R6888:Sar1b UTSW 11 51788192 missense probably damaging 0.98
R7201:Sar1b UTSW 11 51788252 missense probably benign 0.10
R7456:Sar1b UTSW 11 51791354 missense probably benign
R7548:Sar1b UTSW 11 51789267 missense probably benign
R8203:Sar1b UTSW 11 51779697 missense probably benign 0.45
X0065:Sar1b UTSW 11 51782831 missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- CGCACATGCACTCAGGAATTC -3'
(R):5'- AGTTCTTAATTTGTGCTCTGGGAAC -3'

Sequencing Primer
(F):5'- GTCTGATGTCACTCTGACTG -3'
(R):5'- GGAACCAGGTCAATTACTACTTACC -3'
Posted On2020-01-23