Incidental Mutation 'R8013:Sgsh'
ID617016
Institutional Source Beutler Lab
Gene Symbol Sgsh
Ensembl Gene ENSMUSG00000005043
Gene NameN-sulfoglucosamine sulfohydrolase (sulfamidase)
Synonymssulphamidase, 4632406A19Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.107) question?
Stock #R8013 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location119343425-119355536 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 119352695 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 67 (V67A)
Ref Sequence ENSEMBL: ENSMUSP00000005173 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005173] [ENSMUST00000050880] [ENSMUST00000100172] [ENSMUST00000136523]
Predicted Effect probably damaging
Transcript: ENSMUST00000005173
AA Change: V67A

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000005173
Gene: ENSMUSG00000005043
AA Change: V67A

DomainStartEndE-ValueType
Pfam:Sulfatase 23 328 2.6e-60 PFAM
Pfam:Phosphodiest 25 287 5.2e-8 PFAM
low complexity region 348 357 N/A INTRINSIC
Pfam:DUF4976 400 477 1.5e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000050880
SMART Domains Protein: ENSMUSP00000050999
Gene: ENSMUSG00000039908

DomainStartEndE-ValueType
Pfam:Sulfate_transp 31 424 1.8e-97 PFAM
transmembrane domain 426 448 N/A INTRINSIC
Pfam:STAS 453 559 3.6e-14 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000100172
AA Change: V67A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000097748
Gene: ENSMUSG00000005043
AA Change: V67A

DomainStartEndE-ValueType
Pfam:Sulfatase 23 250 1.7e-35 PFAM
Pfam:Phosphodiest 25 237 2.7e-8 PFAM
low complexity region 311 329 N/A INTRINSIC
low complexity region 395 408 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000136523
AA Change: S40P
SMART Domains Protein: ENSMUSP00000115587
Gene: ENSMUSG00000005043
AA Change: S40P

DomainStartEndE-ValueType
PDB:4MIV|H 1 30 1e-5 PDB
low complexity region 40 56 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of several enzymes involved in the lysosomal degradation of heparan sulfate. Mutations in this gene are associated with Sanfilippo syndrome A, one type of the lysosomal storage disease mucopolysaccaridosis III, which results from impaired degradation of heparan sulfate. Transcripts of varying sizes have been reported but their biological validity has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a spontaneous allele die prematurely displaying low sulfamidase activity, variable lysosomal storage in various brain cell types and other tissues, heparan sulfate-uria, scruffy coats, corneal opacities, bladder distension, hydronephrosis, hepatosplenomegaly and bone deformities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik T G 6: 149,328,870 V1138G probably damaging Het
6030458C11Rik C A 15: 12,824,529 D7Y probably benign Het
9530053A07Rik G A 7: 28,137,541 R295H probably benign Het
Ahnak A G 19: 9,009,335 D2661G unknown Het
Akap13 G A 7: 75,730,465 R462H probably damaging Het
Apob T A 12: 8,010,798 N3093K possibly damaging Het
Baz2a C T 10: 128,125,288 R1627C probably benign Het
Baz2a T G 10: 128,125,292 V1628G possibly damaging Het
Bbs7 A T 3: 36,594,387 I404K probably damaging Het
BC030867 A G 11: 102,257,899 N379D probably benign Het
Cacna1g T C 11: 94,456,970 Y764C probably damaging Het
Casr G A 16: 36,509,644 L443F probably benign Het
Cfap43 T A 19: 47,773,109 I849F probably damaging Het
Cntn3 A T 6: 102,199,317 H812Q probably benign Het
Cog1 A G 11: 113,656,164 D528G probably damaging Het
Depdc5 C T 5: 32,973,842 T1229M probably benign Het
Dis3 T A 14: 99,077,399 R954W possibly damaging Het
Disp2 T A 2: 118,789,682 Y298* probably null Het
Dock2 A C 11: 34,705,850 I393S probably damaging Het
Dtd1 A G 2: 144,617,332 D92G probably damaging Het
Eef2 T A 10: 81,178,196 V121D probably damaging Het
Eml1 T A 12: 108,521,679 I550N probably benign Het
Entpd7 A G 19: 43,728,055 D496G probably benign Het
Ets2 T A 16: 95,716,100 L292Q probably damaging Het
Ext1 T C 15: 53,075,887 I589V possibly damaging Het
Fam20a T A 11: 109,685,506 E142D possibly damaging Het
Farp1 T A 14: 121,242,401 I368N probably damaging Het
Fars2 C T 13: 36,205,085 Q186* probably null Het
Fbn2 T C 18: 58,104,081 T617A possibly damaging Het
Fbxo38 T C 18: 62,530,811 E203G possibly damaging Het
Fhdc1 A T 3: 84,474,639 M1K probably null Het
Gatad1 T C 5: 3,643,540 R210G probably benign Het
Gm28363 A G 1: 117,726,804 R58G probably benign Het
Gm8356 A T 14: 6,536,303 N58K probably damaging Het
Grsf1 A G 5: 88,675,756 probably null Het
Hephl1 T A 9: 15,054,609 D1016V possibly damaging Het
Kcnma1 T A 14: 23,373,143 I831F probably benign Het
Krt78 T C 15: 101,948,542 R377G probably damaging Het
Lama2 T C 10: 27,344,498 H457R probably benign Het
Lmnb1 T A 18: 56,708,359 Y83N probably damaging Het
Loxl4 A G 19: 42,607,676 C113R probably damaging Het
Lrba A T 3: 86,417,971 D1912V probably damaging Het
Macf1 T A 4: 123,526,826 T212S probably benign Het
Map3k4 A T 17: 12,271,031 C504* probably null Het
Map4k4 T C 1: 39,962,212 I53T unknown Het
Myo5b C T 18: 74,760,899 Q1700* probably null Het
Npas2 T C 1: 39,338,065 F503L probably benign Het
Nrg1 A T 8: 31,949,923 S149T probably benign Het
Olfr1243 A G 2: 89,527,936 V158A probably benign Het
Olfr155 T A 4: 43,854,958 F216L probably benign Het
Olfr697 C T 7: 106,741,617 V106I probably benign Het
Olfr824 T A 10: 130,126,778 K93M probably damaging Het
Pdia6 T C 12: 17,273,965 L66S probably damaging Het
Prss35 T C 9: 86,755,425 S83P probably damaging Het
Psme4 G A 11: 30,804,320 M192I probably benign Het
Ptprs A C 17: 56,435,994 S383A probably damaging Het
Sar1b C T 11: 51,779,794 P55L possibly damaging Het
Slc16a4 A G 3: 107,311,478 Y465C probably damaging Het
Soga1 A G 2: 157,030,786 probably null Het
Stard9 T C 2: 120,688,101 I502T probably damaging Het
Sugp2 T A 8: 70,251,642 Y610N probably damaging Het
Tbc1d24 G A 17: 24,182,821 P385S possibly damaging Het
Tm4sf1 T C 3: 57,292,898 I99V probably benign Het
Tpr G T 1: 150,398,608 V163L probably benign Het
Usp31 T C 7: 121,649,257 S988G probably damaging Het
Wdr63 T C 3: 146,081,285 T332A probably damaging Het
Zbtb26 T A 2: 37,437,001 probably null Het
Zfp536 T C 7: 37,569,610 N127S probably damaging Het
Zfp750 T A 11: 121,513,017 D344V possibly damaging Het
Zmym5 T A 14: 56,794,426 K408N possibly damaging Het
Other mutations in Sgsh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00954:Sgsh APN 11 119346485 missense probably benign
IGL01549:Sgsh APN 11 119350929 missense probably damaging 0.99
IGL02110:Sgsh APN 11 119352806 missense probably damaging 1.00
IGL02878:Sgsh APN 11 119346558 missense probably damaging 1.00
hindenburg UTSW 11 119350947 missense probably damaging 1.00
ludendorff UTSW 11 119346357 missense probably damaging 1.00
BB005:Sgsh UTSW 11 119347735 missense probably benign 0.03
BB015:Sgsh UTSW 11 119347735 missense probably benign 0.03
R1187:Sgsh UTSW 11 119346578 nonsense probably null
R2342:Sgsh UTSW 11 119347714 missense probably benign 0.01
R2472:Sgsh UTSW 11 119355474 missense possibly damaging 0.83
R2571:Sgsh UTSW 11 119350514 missense probably damaging 1.00
R3872:Sgsh UTSW 11 119350947 missense probably damaging 1.00
R3873:Sgsh UTSW 11 119350947 missense probably damaging 1.00
R3874:Sgsh UTSW 11 119350947 missense probably damaging 1.00
R3875:Sgsh UTSW 11 119350947 missense probably damaging 1.00
R5075:Sgsh UTSW 11 119346768 missense probably benign 0.34
R5660:Sgsh UTSW 11 119350981 missense probably damaging 1.00
R5938:Sgsh UTSW 11 119346799 missense probably benign 0.08
R7302:Sgsh UTSW 11 119347699 missense probably benign 0.02
R7484:Sgsh UTSW 11 119346357 missense probably damaging 1.00
R7533:Sgsh UTSW 11 119347870 missense probably damaging 1.00
R7552:Sgsh UTSW 11 119346552 missense probably damaging 1.00
R7928:Sgsh UTSW 11 119347735 missense probably benign 0.03
R7958:Sgsh UTSW 11 119352773 missense probably damaging 0.98
R8014:Sgsh UTSW 11 119352695 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TACCTGCCCCTAAGGATGCAAG -3'
(R):5'- GGAGTGTCTAGTCCAACTCCTG -3'

Sequencing Primer
(F):5'- CCCTAAGGATGCAAGGGAAACC -3'
(R):5'- TGCAGCAGTACCCTAGGTATC -3'
Posted On2020-01-23